GenePrediction:GLEAN_5290 Details

Name: GLEAN_5290
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:667425..664685 (- strand)
Length: 2741
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:667425..665551 (- strand)
Length: 1875
Type: CDS
Source: GLEAN
Position: GCSC_97:665443..664685 (- strand)
Length: 759
>GLEAN_5290 class=GenePrediction position=GCSC_97:667425..664685 (- strand)
ATGGGCTTTGGAAGACCGTTGCAAGCCGGCTTTGTGCATCGTCTGTTCCACGCCGGCCTTGGCCTCCTCACCGTCTTCGG
CCTCCTCGTCGGCGGCACGCGTGCCCACTCGCAGGAGCGCAACGCCCTGCGCAGCCTCTTCCGGGTCGACGAGGCAGTGC
TGCACACGGCCACACACCGCGTCCATGCCCTGTCACACTTCCAGATCTCGCTGACGCTGCACCAGCTGGACTCGGACCAG
CGGCTGCCCGTGCGACTGCGACTGCGACCCGATAGCGACACCATTGCCGAAGGCGCAGCCATCCACCATCACAATGCCGA
CGGCTCGGTCACGGTGGAGCCCATCCGGCGGCTGGATCACCGGTTGTTCCAGGGCGACGTTTTCGTGCCGAGTCAAGGGG
TGGCTGCTGCGACGAATCACTGGACCAACGCCGGATGGGCCAGTATATATGTGCACGTAGACGGGGTGCATCCGGTGTTT
GAGGGCGCGTTCCGCGTGTTTGGCGACCACCACCACATTCAGACGAGCGCCAATTACCTGGACACACGGATTTGGGGTGA
CCCGCTGATCCCGACCGGCGCAGACGCAGGCGCAGACGCTGGAGATTATATGGTGGTATGGCGCGACTCTGACATCATGG
CGCCGGGCGCCGAGACACAGGCAGCAGGAGATGAGTTGCGACGGCGGCTGCGGCGACAGCACTCAGCAAATGGTATTGTG
GAAGAGCTGCCACAGCCGGCCTGCTCGTCGGACGAGCTCTTGTTCAATATGGACGAGATGCATCCTGTGCACCGTGGCGG
GTCGAAGGTGGAGGTGCCGTCGTCGGCATCTGCTTCGTCAGACGTGCGGTCGTGGCTGTTTGGGCGACAAATCGACGGGA
CGGGAAGCACAGGCGGCAACTCAGCGGGCGTGAACCTGACGTCGACGATCGGCAGCTCGTCTGGCTGTCCGACGACGCGC
AAGGTGGCACTGATGGGGATCGCAGCCGACTGCACATACATGCAGGCGTTCCCGAGCAGGGACAATGCGACAGCCCACAT
CGTGCAGCAGATCAGCTCGGCGTCCAAGGTGTACGAGAGCACGTTCAATGTGTCGCTGGCCATCAAGAGCCTGGTGCTGC
AGAGCGACACGTGCCCGAGCTCGCCGTCGTCGTCGGTGACGCCGTGGAACGCAGGCTGCAGTAGCAATCTGACCATCAGC
GACCGGCTCAACCTCTTCTCGCAGTGGCGTGGCACGAACAACGACACCAATGCGTTCTGGATGCTGCTGAGCACGTGTGC
CACTGACTCGGCCGTCGGGCTGGCTTGGCTGGGCCAGCTGTGCGTGCTGGGGGCCGAGACAAGCGCGAGTTCAGACGGTA
GCGGCAACGAGACCGTGGCGGCGACCAACGTGGTGGTGCGGACGTCGACGGAGTGGCAGGTGATGGCCCATGAGACCGGT
CACACGTTCGGGGCGGTGCACGACTGCACGAGTTCGACGTGTGCCGACGGCACGGCGACGAAGCAGCTGTGCTGCCCGCT
AAGTGCGTCGACCTGCGATGCTGCCGCCGGCTATATCATGAATCCCAGCACCGGCAGCGGCATCACGCAGTTCTCGCCCT
GCACCAAGGGCAACGTGTGCGCGGCGCTGGGCCGCAACAGCGTCAACGGGACGTGTCTGAGCGACAACCGCGGCGTTGTG
TCCGTCACGGGGAGCGTGTGTGGAAACGGCATCGTCGAGGAGGGCGAAGACTGTGACTGTGGCGGAACCTCCGGCTGTGG
CAGCGATAGTGCATGCTGCAACCCGGAAACTTGCCACTTTGCCACCGGCGCTCTATGCGATCCGGCCAACGACGAGTGCT
GCACGTCCGCCTGCCAGATGGCCAGTGCCGGCGTTGTGTGTCGGCCCAGTACCGGCGACTGCGACCCGGCCGAGACCTGT
TCCGGCACGGCTGCCTCCTGTCCGGTCGACACGACGGCCGCCGATGGAACGGCCTGTGGCAGCAATTCCAGCTCCAGCTC
CGGCTCGCTGGCCTGTGCTCCGCCGGCCAGTGCACGTCGCGCGACCTGCAGTGCCAGACGCTGATGGGGTCGCTGGCCAG
CAGCGGCAATGACACGTACGCCTGCAGCGACCAGGGCTGCACGCTGAGCTGTGCTTCGCCGGCCTTCGGTTCCAATACCT
GTTTTGAGATGATGCAGAACTTCCTCGATGGCACGTCCTGCGAGGGCGGCGGCCGGTGCAGCAACGGTGTCTGCAAGGGC
TCGTCCGTCACAAAAGAGATCGCTTCCACCTTGCGCCACAACCTCACCATTGTCATTCCTGTCGCCTGTGTCGTCGGCGT
CCTCATCTTGGCTGCCCTGTTGAGCTGCATCTGCTCCTTCTGCCGTCGTCGCCGCAACCGCCGTCTCCGTCGCCGTATGC
GCAACGGCTTGCCGCCTTCCTCGGCTGCCGCCATGCCCATGACCGCTGCCGCCACTTGGGGTCGAAATCAGCACGGCAAC
CGAGCTCAACCGCCAAAGCCTGGAAATATGGCCATGGCAATGCCTCCAGCTCAGTGGCAGCAGCAACAGCAACAGTCTGG
TCCCTCGCGATGGAGCCTTTGGGGCGGCAACAGCAACCGCAACGACAGGTCTTTTCCACAAGCCGACCCCGTTGCTGGCA
CTTATGCTGCCGGCACCCAGATGCCGCCACCGCCGCCTTACTCGCAGCAGCAGTCACAGTGGGGGCCGCCACCCCAGGGC
CCAGGTATGCGATTTGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62