GenePrediction:GLEAN_5292 Details

Name: GLEAN_5292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:645974..642963 (- strand)
Length: 3012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:645974..645845 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_97:645786..645500 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_97:645420..645241 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_97:645167..645075 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_97:645014..644858 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_97:644794..644550 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_97:644483..642963 (- strand)
Length: 1521
>GLEAN_5292 class=GenePrediction position=GCSC_97:645974..642963 (- strand)
ATGTCGATGCATATGCATCACGGTCCTCCGGGTCCTGCACCTCCTCCACCGCCTCCTGCTTCAAGCTATGCAACAGCTGC
CCCTTCGCGCCAAATCACGGCCATGAACGAGGCTGTCTGGATGCAAATTGGTACGTGTTTTCGGTGATGACAGTTCTTGT
TGCAACAGCTTGCTGACCTTTACCACAGGCAGTTTTGCTGAGCTCCTGGGAAACCCCGAGGAAGCTATGGGTGCCTACGA
ATTCGCCCTTCGCGCCAACCCCCAGTCCATACCAGCTATGAACGCCATCAGCCTCATTCTCCGAACACGCGAGGATTTCC
CAAAGGCCATCGAGTACCTACAAGCCATCTTGAAGCTGGATCAGAACAATGGCGAGGTTTGGGGTAGCCTTGGCCACTGC
TACTTGATGATGGACGATCTCCAACAGGCCTATGCGGCATACCAGTCAGCGCTGGTAAACCTGAGAAATCCAAAAGTGGG
TGTTCTGTCTTTCGCGTTGACGGCGCCATTTTGTTGCTCTCTTATAGCGTGTTACTTACAAAATCTCCCCGTAGGAGCCG
AAGCTTTGGTATGGTATTGGCATCCTCTATGACCGGTACGGTTCTCTTGACCACGCTGAAGAGGCTTTCTCCCAAGTCAT
GTCGATGCAGCCGGACTTTGAGAAGGCAAATGAAATATACTTCCGACTGGGTATAATTTACAAGCAACAACAAAAATACA
ACCAAAGCCTGGAGGTACGCATTTATCAGCTTCTATGGCTGTACGACACGCTTTTGAGCTTAGAACGACAACTAATAATT
TTCGCAGTGCTTCAAGTACATCGTCAACTCGCCACCCCCTCCTCTTACCGAGGAAGACATCTGGTTTCAGATCGGCCACG
TGTACGAGCAGCAGAAAGACGTAAGCATCTGCAACAAAAAACGAGAATTATTTGCTTCTTGTGCTGACCACGTTTTGCAG
TTTGACAACGCCAAATCCGCGTACCAACGTGTCCTTGAGCGCGACCCCAACCATGCGAAAGTCCTTCAGCAGCTCGGCTG
GTTATATCACAACCAGAGCAGCAGCTTCTCAAGTCAGGACCGTGCTATCGAATATCTTGAGAAGTCTGTTGCGGCCGGTG
AGTTGAAACCCCAATATGCCCTTCCATGAAGTCTCGGCTCTGACAATGCCATTTTTACAGATAACAACGACGCACAAAGC
TGGTATCTGCTTGGCCGCTGTTACATGTCTCAGCAAAAGTATCCCAAGGCATACGAGGCATATCAGCAGGCTGTTTACCG
CGAGGGTCGCAACCCTACTTTCTGGTGCTCGATCGGTGTTCTCTACTACCAGATCAACCAGTATCGGGATGCGCTGGATG
CGTACTCACGGGCGATTCGCCTGAACCCGTTCATATCGGAGGTGTGGTATGATCTTGGCACTCTGGTAAGATGTTTCAAT
CCACTTTACAGATGCACACATGCGGTGGCAATATACTGACTTCGTGCATAGTACGAGTCCTGCAACAACCAAATCAGCGA
CGCCCTCGATGCCTACCAAAGAGCCGCGGAGCTGGATCCCAACAACCCCCACATCAAAGCCAGACTGCAGCTGCTTCGCA
ATGGGTCGAACAACGGAATTGGCAGCGCACCGATGCCTACGGATGTCCACCCTCATGCGTACCAGACAACGCCGGTTGGG
CCCCCGGGTCCTCAGTGGGGTAACTCGGGCACCCAGCAGTCAGCGCCCATGAACGGCCCTCCTCCGCCGCCGGGCCCGGG
GTCCAACGGATGGGGACGTCTGTCGGAGATTAACCCTCCCCCTCAGCCGCCCAACCCGTTCGACCAGCGCGAGCTGTACA
GAGGCCAGGCTCCTCCGGCTGTGAGGCCGCCAAGTCCGCGCACGGATCCGCAACTGCGCCCGTACCCAGAACAGGGTCGC
CCGGGACCCAACGGAGTCAGCGGTCCTAGCCTATTGGGATCTTCCGGACCGGGGGGTCCTCTGCGACGTCCTACGCCTCC
ATCGTCACACTACGGCCCACCGCCGCCGCAGTTGCAGCAGCCACAGCCGCCGCCGCAGCCACGCGTGCAGAACAGCAGCT
ACATGGGGGGCGCACCGTCGTCTCTTCCTCCTAACAACGGAGTCAACGGGCCGCCGCCACCGCCGGCCGTCGTGAGCCCT
CGTGGATATCATGCCCCAAGCCCACGCAACGAGACCCGTGGTGTTGTGCACGACACGCGCATGCCGTCGCCCAAGTCGGC
GTACCCGCAGCATCAGCCGCCGTATTCACACCCGGACCAAAATGTGTCGGGTCCCATTGAGTCGGGTCCACCACCGCCAC
CGCCTCAGTCAATGCCGTCCGAGGGTAGCATGCACCGGGATGATCGTCCGCCGTCGGTCGGCCCCAAGAGAATGCGAGAG
TGGGAGGACGACACGGCTGCCAAGAAGCCTGCTTCTGAAGAGGCTCGTGCGCGTCTGGACGACATTCATCACCGCCGGCC
CTCAACGCCTCCCCACGAGCCGTACCGCCGCAATTCGTCTGAGGCTAGGCGTTTCGATGATCAGCGTCGGGGGGAAGACC
AGCGCCGCCTGGAGGATATCCGCCGCACAGATGACCCGCAACGTCACGCAAACGATGGCTACCACCCATCTGAGGCTGCC
CATCATCAGCCTGCGCATCCGGTGTCTAGCCACCTGCCGCCTCTGCAGTCGGGTCCCTCTCACATGCACGATGGTCCGTT
GTCGGGCCCTGATCCAAAGGACTACCCACAGGAGGAGCGCAAGCAGCGGTTGGAACACCAGCCGCCGCCTCCGCCACCTC
CCCCTATCAGCGAGCCCGAGCGGGCTGCACGGAAGGTCGATGTAGACGAGGACTACGATGACAGTGGCGAGGACGACAAG
AAGGCAGGGGCTGCTACCAGCGCGGCTGGGCCAAGCTCTACCGGTGCTGCATCTGTGTCGGGCGAAATCAAGACGAGCAC
ACCTACTAGTGCTGGCGTCAATGGCATAATCACAAAGTCTGAAGCAGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62