GenePrediction:GLEAN_5293 Details

Name: GLEAN_5293
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:635022..630151 (- strand)
Length: 4872
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:635022..634975 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_97:634915..634768 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_97:634709..634677 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_97:634623..634496 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_97:634410..634335 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_97:634282..634169 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_97:634096..633869 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_97:633813..633475 (- strand)
Length: 339
Type: CDS
Source: GLEAN
Position: GCSC_97:633422..633379 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_97:633317..633090 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_97:633023..632987 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:632883..632851 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_97:632789..632631 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_97:632013..631385 (- strand)
Length: 629
Type: CDS
Source: GLEAN
Position: GCSC_97:631326..630151 (- strand)
Length: 1176
>GLEAN_5293 class=GenePrediction position=GCSC_97:635022..630151 (- strand)
ATGGCGGCCAAAACCGGAGCAGCTGCGGCGCCTCATGAGATTTTCGACGTGAATATAGCCATGCAATGAGTCAGACACAT
CGAACACCAGCTAATTGTGATATCTAGACAATCCTTCTCTTGGACTTTGGAAGCCAGACCTCGCATCTGATCCTCAGAGG
TCTCAGATCACTCAATGTGTTCTGCGAGATCATGCCATGCACCACCAAGATCAAGGATCTGACTTGGAAGCCCAAAGGAA
TTATCCTCAGCGGAAGTGAGCGCCCCTCTGAAGTCGCATTCGTGAGGGGCTGATTTTCTGACCTAGTGCCTAGGCCCCGC
GTCTGTGACTGATGCGGGAGCTCCTCGTAAGTTTGCTTCCACTACATGCCAAATGACTCAAGGGATTGACTCGGTATAGA
CGTCGATCCTGCCATCTTTGATCTGGGCGTGCCCATCCTCGGAATTTGCTACGGTTGCCAGGAACTTTCCTGGCGCGAAG
TCTCTGATTCCGTTGCCCCAGGCAAGGCTCGGGAATACGGACATACAGTATGTGTGCCTCGGCATGCAATCTGGGACGAC
TTGATCTATAATTGAGAAAGCAGTGTTCGCGGTGCTAATCTATTTCCTAAAGGATCTTACCATTTTTAAAGTCGATGGCC
CCGACCATTCCAACAAGCTCTTCGAGGGTCTGGGAGAGTCTATGCACGGTAGGTCATGTCCTTTATAAAGTGGCAAAATG
CAAAACTGATAGGTCGGCAGTCTACATGAGCCACGATGACAAGCTCATCAAGCTGCCAAATAATTATGCCGTGATTGCCA
GCTCGCAGAACTCCGAGTATGCCGGAATTGTCCACAAGACGAAGCCGATCTACGGTATGTGCTTCCTGAAGCCTCGTCTT
GCACATCGCGCCCATTTGGTGACAATCTGACTCGAGGCGCTTGTAGGAATACAATTTCACCCCGAAGTCGAGCACACCCC
GCGCGGCATAGATCTGCTGAAGAACTTCGCCGTCAGCATCTGCAAGGCCCAGCAGCACTGGGTCATGAGCGACTTCATTG
AGCATGCGATTGCCAGCATCCGCGAGCGCGTCGGCGACAAGGCTCAAGTCATCGGAGCTGTCTCAGGTGGTGTCGACAGC
ACAGTCGTTGCTCGGTTGATGAAGGAGGCTATTGGTCAGTTGTGCCTGCCACTGAGAGCTTTTCGCGGTGTGGGCTAACC
CTAGGCTAGGTGACCGGTTCCACGCCGTCCTCGTCGACAACGGCGTCATGCGTTTGAACGAGTGCGCAGATGTGAAGAAG
GCGCTTCAAGAACATCTCGGCATCAACCTCACGATCATCGACGGAGGGGCGCTGTTTCTTGGTCGGCTCAAAGGCGTCAC
GGAGCCCGAAACGAAGCGGAAGATCATCGGCGGCACTTTTATCGACCTATTCGAGGAGGAGGCCATCCGCATCGAAAAGG
CTGCTGAGAACACTGCCAATGCCGGCAAGGTGGAGTTTTTCGTCCAGGGCACTCTATACCCTGACGTCATCGAATCGCTT
AGCCTGAACACGAACAACACGGTGAAGAGTGAGCACACCCGCATTCCTTTCTTATAGAATCTTGTTACTAATCGATGCAG
CGCACCACAACGTTGGCGGCCTTCCGGCTCGGATGATGAACGGCGTAAGCAGCTTCCTAAGAGTATAGCATGCACGTGAC
CAGCGACTAATCTAAACAACAACAGCAAGGCCTCAAGCTGATTGAGCCCCTGAGAGAGCTATTTAAGGACGAGGTCCGGG
CCTTTGGCCGGAAGCTGGGCATTCCGGATGACCTGGTCATGCGGCACCCATTTCCGGGCCCAGGTATCGCGATCAGAATT
ATCGGAGAGGTCACACCCGAGCGCGTTGAAATTGCTCGCAAGGCCGACCATATCTTCATCTCCATGATCAAGGAGGCAGG
AATTTACGACAAGGTGAGTGCATTTGATGCCATCCTCTGTGCCATTTTGGCTTGCCTGTGGTTAACCTTTTCGACTCAGA
TCGCCCAAGCCTATGCCGGCCTGGATTCTAACAGAGGTATATATTACAAAAGTGTACCCGCTTAGAGATTGCGAAGATTT
CCTCTCAGACCTGAGCTCTCAGATGAGGACGCCATGCTAATGATTGCTTTGTGCTTTAGCTGTGGGAGTCATGGGAGATG
CCCGCGTCTACGGTATGTTGCCCTCTACACGAGTTACCTGAACGATGTTTGCTGTTTATTAATGACTGTCCAGGATACAT
TATCATCCTTCGCGCCGTCATGTCCACTAACTTTATGACGGCTGAGCCTTACCCATTCGATTTCTCGTTTCTGACACAAG
TGTCCCGGAGAATTATAAACGAGGTTCCTGGAGTCGCTCGCGTAACCTATGATATCACGAGCAAGCCTCCTGGTAAGATA
CAGGCATGCAAGCCAAATGGAAGAGTTTAGTCGCTAATGTATTTATAGGTACTATTGAATTGGAGTGATTGGGAGACGGA
TCTAGTGGACGACATCCCTAAATTTCTCGAATCACCAATTCCTGCTTTCGAGTATAGGGCATTTTCAAGCAACAGGCGTT
TCCCAGATTACTGATTTGAAACGACAGAATATACACGTAGAAAATAAGCAAACCAAAAAAAATAGAGTGATATTCTCAGC
AAGCCTCTTGTAGCAGTTCACTGTACGGGAAGTCGCAGACCAATGCAGTAGGGACCTGAACTTTCCCTTTTGGGCGTCAG
GAGTTAAGACGCCGGAGGAACATATTCCGAGCTAATCCCAATACGGACGTCGAAGGTGCCGAATGCAGTGGGGCAGAAGT
AAAAAAAAAGGCACCACATATCAACGCAAAGAGGACAAGAAGGAAAGGCTCTGAGCCATTGGCAAGCAAGAAAAGGACGA
ATTTCAGGGACACGGAAAAAGAGGCGAAACTCGAGACAGGTCAAAGTGCGGAAGGTCAGCGAGATATCGGCTTGCAGCCC
GGCCAGCGAACGTTTCCAGCGTCGGTCTGACTCATTGGCTACTGCGAAGAGTCACCCGAGAGCAGCGGCTATTTGACGAG
AACCAGACAGAGACATCCCATACCACTGACATTACCGCTCATCCAACAGTGCATTTTGTGCTATGGAAGGACCTGTAAGC
ATGCTGAGAGCCCCTTTCCCGTCCTCTGCTTCCTCGGTCCCCCCACTTCCACTCTGCAGCTTGCTGACATGGACGGTGGC
CAAAAGGATGTGATCGTGCCGTCGCTCGAGACGGTGAGCGAAGTGCTAGCCAATGTGGTGACGACGGCTAAGGCAGAGGC
GGCCAAGGGGCCTGGGTCGACATACCGACGGCCGAACTTGGTGCCGGTATACGGGCAGATCTCGTCGGACCTGATAACGC
CGTCGGCAGCATATCTAAAGGTGTCGGCGCACTCAGGGTCGAAGCACTCGTTCCTATTTGAGAGTGCGGCAACGGAACGG
GTGGGCCGATACAGCTTCCTGGCAGCGGGGCCGCGCAAGGTGCTGGAGACGGGGCCGGGGTTCGGCGAGGCGTGCGACCC
GCTGCCGGGACTGGAGGTCGAGCTGTCGCGGTTTGTGGTGGCCCATGTTCCAGGGCTGCAACTGCCGCCTCTGGCGGGTG
GTGCGGTGGGCTACGTGTCGTACGACTGCGTGCGCTATGTGAGTGGAGTTGTGGGAGTTGTGGGAGTTGTGAGCAGCATC
TCTAACGCCGTTCTAGTTCGAACCGAAGACAGCACGACCGCTCAAGGATGTTCTGAAGATCCCCGAGTCTCAGTTCTGTT
TCTACGACACGATCGTGGCGTTTGACCGGTTCTTCGGCATTATCAAGGTGATCACGTACCTGCAGCTGGACGCGGTGGCG
CAGGACAGCACGACGGGGACGTACGAGGCAGCGGCAGTGGCAGCAGAATACCGACGGGCGACAGGGGTGATCCGGGCACT
GATCGACGTGCTGAACGGGCCGACGATCCCGCTGCCGGAACAGAAGGAGGTGGTGCTGGGGCGTGAGTACACGTCCAACG
TGGGGCAGGCGGGCTACATGAGCCATGTGGCGCGGTTGAAAAAGCACATTGAGGCGGGCGACATCATCCAGGCGGTGCCA
TCGCAGCGGTTTGCACGGCCGACGGATCTGCACCCGTTTAATGTGTACCGGCACCTGCGGACAGTGAACCCTTCGCCATA
CCTGTTCTACATTGACTGCGGCGGACGACCTCAGATCGTGGGGGCGTCGCCGGAGCTGCTGGTCAAGACCGAGGGCGGGC
GCGTGGTGACGCACCCGATCGCCGGCACGGTGAAGCGCGGCCGCACACCGGAGGAAGACACCGCGCTGGCCGAGGAGCTG
CGGCAGTCACTCAAAGACCGGGCTGAGCACGTGATGTTGTGTGACCTGGCACGCAACGACGTCACGCGGGTCTGCGATCC
GCGCGAGACCCGGGTCGACCGGCTGATGGTGGTGGAAAAGTTCTCACACGTGCAGCATCTGGTGTCGCAGGTCTCGGGCG
TGCTGCGGCCGGGCTGCTCGCGCTTCGACGCCTTCCGCAGCATCTTTCCAGCCGGCACGGTCTCGGGCGCGCCCAAGGTG
CGGGCCATGGAGCTGATTGCCGAGCTGGAGGGCGAGAAGCGTGGCGTGTACGCCGGTGCTGTCGGCTACTTTGGCTACAA
CGGCGTGGCCGCTGACGGGGTCACGCCCGTGGACGGCCAGATGGACACGTGCATCGCCCTGCGCACCATGGTGCTCGCCG
ACGGCGTGGCCTATCTGCAGGCCGGTGGTGGCATCGTGTTCGACAGCGACGAGTACGACGAGTGGGTCGAGACCATGAAC
AAGCTGGGCGCCAACATGCATTGCATCACCTCGGCCGAGCAGCTGTATGCGCGGCGGCAGCAGGGAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62