GenePrediction:GLEAN_5294 Details

Name: GLEAN_5294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:609868..606813 (- strand)
Length: 3056
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:609868..609687 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_97:609622..609540 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_97:609476..608474 (- strand)
Length: 1003
Type: CDS
Source: GLEAN
Position: GCSC_97:608046..607036 (- strand)
Length: 1011
Type: CDS
Source: GLEAN
Position: GCSC_97:606906..606813 (- strand)
Length: 94
>GLEAN_5294 class=GenePrediction position=GCSC_97:609868..606813 (- strand)
ATGGCCGCTGGCGACTCCGAGCGGGTGCAAGAGGCCAAGAAGCTGGCCGTCTCCAATCCAGCAAAGAGCGAGTCGATCTA
CAAGGATATCATCTCAAAGACGCCGTCCGTCACGTCAGATGCCGCCATCCGGGAGTACGAGACGGCGCTGATCAGCCTGG
GAGAGCTGTACCGGGATCAAAAGTCAGTCTACAGAAGAGCTGCGCATGTGGCAGGTGAGGACTAGTCGAATTCTGACAGC
TCACAGAAACACGACCGAGCTTGTTGAGCTGGTAACGCGGAGCCGGACAGTGCTCTCGTCGTTTGCAAAGGCAAAAACTG
CCAAGCTGGGTATGGATGGCTGCGTCCCCCTCCCTCTCCAGTAGATGTCGCTCACACATATCCGCCATCCAGTGCGCCAG
CTGCTCGACCTCTTCCGCGAGATACCCAACACGACCGACACACAGATTGCCGTGACCAAGTCCTGCATAGAATGGGCGAC
GTCGGAGCGCCGCGGCTTCCTGCGGCAGAACCTGGAGACACGGCTGGTGGCGTTGTACATGGCGAAGCAGGCGCACTACG
ATGCGCTGACGCTGATCAACGGGCTGTTGCGGGAGCTGAAGCGGCTGGACGACAAGCTGGTGCTGGTGGAGGTGCAGCTA
TTGGAGTCGCGCGTGTACCACGCGCTGGGCAACGTGTCCAAGGCGAGGGCCGCGTTGACGAGTGCGCGCACGAGCGCGGC
GTCCGTCTACACGCCGCCGCTGCTGCAGGCGAACCTGGACATGCAGTCGGGCATGCTGCATGCGGAAGATAAGGACTTCA
ACACAGCGTTCAGCTACTTCATCGAGGCCCTGGACGGCTACCACACGCAGGACGAGCCGGCCAAGGCGACAGCGGCCCTG
CAGTACATGCTGCTCTGCAAGATCATGCTCAACCTAGCCGACGACGTGAACCAGCTGATGGCGTCCAAGCAGGCGGTCAA
GTACGCGGGCCAGAGCCTCGAGGCCATGAAAGCCATCGCGCGGGCCCACGCGAACCGCTCGCTGGAGGAGTACGAGCGCG
CTCTGGCCACGTACCGCTACGAGCTCGGCAGCGACGCCTTTGTGCGCAACCACCTGCGCCGTCTCTACGACGCCATGCTG
GAGCAGAACCTGGTCAAGGTGATCGAGCCCTTCTCGCGCGTCGAGATCGAGCACATTGCCCACATGGTCGGCCTCGACAC
CCAGCAGGTTGAGCGCAAACTGTCGCAGATGATTCTCGACAAGGTCATCATCGGCGTGCTCGACCAGGGCGCCGGCTGCC
TGATCATCTACGACGAGACGGAGCGCGACGAGGGATACGACGCTGCACTGGCCACCATTGAGAAGCTGAGCAACGTCGTC
GATGTGCTGTACACAAACCAGGCCTCGCAGCTGGAGTGAGTGGCCGGAAGGCAACGCCCGCGGAGACACGCGGAGGCGAA
TGGGGCAAGTTGCCGTCAAAGAGGCAGCTGAGATTGTCGTGTATTAGTACTGGCATAGAGAGATCGCTTGAGGCGTTTTG
TCAATCTACCCAACCATTCGATGGCTCGGCCAGTGCATAGGCAGAGACAAGACCACCCATTCCGTAGAACTTGATCCCAG
GCTCCAATAAGAAGCGAGCTTCCAACAGCGGCGCTCGTTGGCGCTATAACGGGGTTACCGATAGCGATAACGGTTCTGCA
TAACACGCCAGTACTCAATTTTTTCGTCGTCGCCTTTTCTGCCGGTCACAGCAGAACGACGTCGAGAGAGATTTGTTCGG
GCTGCCATGAACACGACACGCTGTGCCTGCCGTACGTCTGCTCTCCGGATATTCATCAGCAGTCTTATCGGTCCCCCCAC
CACACAGCAATGGCGACGGCTCAGCGGGCTGCCCGGGCGACCAAGCAATAGTGCCAACATAGCTCGCTATGCGCTTCGAC
CCATAGCACGGCGGCCGCTCGTTGTCGCGGCGCTGCAGCCAGACAGACAGGCGCACTCATATCTTGCGACGGACGGCGCA
AGTGCAGCCGTGGGCGGTGTCGAGTTGGCGGCGCCACCAGCGTCAACCGATCCTGTCTCGATGGTAGAGCCAGGCGGAAC
GACGAGGCAGCAGGCTGTGGCCGGTGCACAAATGCCAGGGAAGCACAGGAGGAAAAAGCTGCGAAAGCAGCAGGAAGCGG
AGGCGGCACGAGCTGCTTTGGGAGCGGCAGCAGAGACGTCGACCGTCTCCGAGGCTGCTGCTGGCGAGGCGCCTGTTGCG
GGTGACAGCATCATACACGAGGAGTTGCCCGAGGACACAGCAGCAGGAGATGCAGGGGCTGAGCCGGCAGAGAAGAAGCG
GGTCAAAAAGCCAAGATGGACCGACGCCCAGCGTGCAGAGCGGCGCCTTGCCAGCTCTGCCGCTTTGCGGTCAGAGCCAT
CATGGTCAGAGTCATCAGAGCCATCAGATTCATCACGATCGCCACGGTCACCACGGTCACCACGGCCATCACCATCGACG
CTGCCACCGCGCATCCCAAGCTGGAAGATCCAGAAGCGTGCGCTCCAGGACAAGTTCCCCGACGGCTGGCAGCCACGCAA
GAGGCTGTCGCCGGACGCGCTCGAGGGCATCCGGGCGCTGCACCGGCAGTTCCCGGACGTGTACACGACGCCGGCGCTGG
CCAAACACTTTATGGTGTCGGCGGAGGTGGTACGACGCATTCTCAAGAGCAAGTGGCAGCCGCAGCCGGCCGAGGAAGAG
GACCGACAGGAACGCTGGTTTAGGCGCGGCAAGCAGGTGTGGGCGCGGTGGGCGGCGCTGGGACGGAAGCCGCCGAAGCG
GTGGCAGGCCGAGGGGATCCGGCGGGACTCGTCGTGGGCAGGCCGACGTCAGCGGCAGTTGGAGGGGGGCGAGGGGGTGG
AGAGGGTGGAGAGAGGGAGAGACGAGGAGGAAAATGAGAGAGAGGGAGACGAGAGAACGAGAAGGGAGGAAGTCGTGTCC
AGACCGATGAACGAGAAGAAGCTGCTGCAGGTCGTAGCCGTCGGTCAGCCGAGCCAGAGACGGACAGACCCAGAAGAGGA
CGCACGCAGAGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62