GenePrediction:GLEAN_5297 Details

Name: GLEAN_5297
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:585586..584393 (- strand)
Length: 1194
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:585586..585400 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_97:585337..585233 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_97:585150..584928 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_97:584852..584393 (- strand)
Length: 460
>GLEAN_5297 class=GenePrediction position=GCSC_97:585586..584393 (- strand)
ATGCGACTTTACGCGGCCGGCTTCAACGCCTGGAACCAGCTGCAATTTCGTACCTGGGACAAAGCCGAAAGCCAAGATGA
TACACCTGACTGTGAAGGGTCAGAACCGAGCGACATTTATCCCTTCTCTTGCATTCTTGAGTCGGAGAAGCTTGGAGCCA
TCCAACCGTTCCTCACGTTTACTACTTGTTAGACAATAAGCAAATGAACCTGCCAACTCAATTTTGGTCACTGACAAACT
GCTCTTTAGTGACAACTGCCAAAGGCCAGCTGTTAGCCGGTGCCGTGCCAGAGCCCTTCAACAGCGGTCATGATGACTAC
AACTATGCCGAGGCTATGAACGGCCGTGTAGTTGGTAAATATATTCTTCGCCAGGCAATTTGTTCTGTACCTGTGTTTTC
TTCTTCGGGGTAAACTGACACTGCGCATACGGCCAGTCTATGACGGTGCCGGTAGTATTTACCAGTATTCGTCGGTGGCA
GACTATTACAGGCGAAATGAGTCCGAATTACAGCGCACAGTCTTCAAAAGGCCTTCTGACATTATACAGACGGTGGCATA
TGATACCGGCTTTGCTGCTCTCACCTCTACCGGTCAGGTCTGGACCTGGGGGGATGGCCGCTTTCCCGAGTGCCTTTGCC
GGAGCGTGACAGAAGAGAGGTCAGTGCTGATGAGGCATCTGGGCAAGAAAACGACAAGTCATTGTTTCGGCCTTTCTTCC
TAACACCTGTGCAGCCCAGCGGACCGGCCTGGCTGTGCCACCTGCCTCGAAGACCTCCCTACCGGTCCCATCGTCAAGAT
TGCTGCAGGCGGCTACGTCCTGACAGCTCTGACTAGTGGCCGCGATCTCTATGCCTGGGGCGGGTATCCAGGGCGACAGC
CGGTGCTCGAGGGGCTCACGGGCGATCCGGTGCCTATTGTGGTGGTGATGGAGAGCGAAGATAGCAGTGATGATGCAGAT
ATTGATATCGTGGACGTTGGCGTGGGCGAGGAACACATGATTGTGCTCATGGCAGACGGAACTGTGTGCGCCATAGGTAG
CAACAGCAACGGTCAGCTCGGACTGGATCCTGACCAGCGTGCAGCTGCATCCTCGTGGGTCAGGGTCCCCATCCCTCTAC
TCAGTGACGAACACGTCGTGGACGTCGTTGCTGGGCCAAGGAGCTCTTTTGTGTTAGTAGACAAAAAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62