GenePrediction:GLEAN_5298 Details

Name: GLEAN_5298
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:582255..580973 (- strand)
Length: 1283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:582255..581188 (- strand)
Length: 1068
Type: CDS
Source: GLEAN
Position: GCSC_97:581110..580973 (- strand)
Length: 138
>GLEAN_5298 class=GenePrediction position=GCSC_97:582255..580973 (- strand)
ATGGACTTGCGACCTCGACAGGCGGGTTTTGGGTCTAGCTGGTCTGGACCCAAGATGAACACAGAAGATGTTACAAACGC
TGCAACAGTCGACTCGTCTGCCGCCAGGCAACGGCCGATTGAACGCGACCTGGACGCAACCAGCAGCTCGCACGACTATT
GCCAAACTACGACACATGCCGGACATGGTGAGGCGGAACCTCGTCCCGACACGCATCCCCCTGCATATCAGCACAGGCAA
TTCAAGAGGCGTTACAAGCCCCGGACCTGCCGCATCTGCCTGGAGGTTGTGTTACCGACGTTTGACGATGCGGACGAAGC
TCTTCATGAGGAGGAGCCTGCTGCGGACGGTGTAGACGCCGTCGTTGGAGGAATCGAGAGGATCGGCGTACGAGTTGCTG
GGGCGATGGCCTCGGCGATCCCGTCTTTTCTTCGACCGCAACCCCGTGTCCGCTACGTATCGGAAGACCCTCAAGACGGC
CGGTTGGTCTGTCCGTGCCACTGCAAGGGTACGCAAAAGTACGTCCACGAGGGCTGCCTGACGGCTTGGCGACATGCGCA
GCCGCTGTCGGGCCGTCACTACTGGAAGTGTCCAACGTGCGGGTTCGAATACCGCTTTGAGAGGCTGCGCTGGGGCCGGT
GGATCTCGAACCGGGTGACGAGGGCAACGCTGACCTTTCTCGCCTTCTGGATGGCCATCTTTCTGCTGGGATTCATCGCC
GACCCGCTCATCGACCTGTGGCTCGACCCTGCCAATATGATCGCTGACACGATCAGTGACTTCGGCGACCCGGATACCGG
CGATGATATTTTGGGGAATCTGGCGGGCATCTTGCATCCACATCACGGCGATGACAGTGATTGGAGCGCTACAGGCTGGG
CGGAACACTTTCTCAAAGGGGTTTTCTCGCTTGGCATCGTGGGCGTGATCAAGACCTTCTTAGCCGTGTCCCCATTTACT
TGGTGGAACATCCGGGGCCGGGTTAGGCGCCGTGCCGGTGGAGGACGGGCACGAATTGAAGGGTTTGGCTGGATGTTTGT
TCTCGTGGGCGCCTTCACATTCTTGGGGGTATGTCCGGCGATTTGCTACACTACCCTCTATCCGTTTCTTTCCGGGAATC
CTATACTGACCCTCGTCTTCATTAGGTTGCGTGGAAGGGAATAAATTATTTGAGTGGTCGTGTCCTTGAACGGGCAAGCG
AACATGTGGTCGACATCCATGGAGATGAAGCAGACGAAAGCGATGCAGATGATGATAACGAAGGTCAACCCCAGGACGAT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62