GenePrediction:GLEAN_52 Details

Name: GLEAN_52
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:366706..368019 (+ strand)
Length: 1314
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:366706..366752 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_179:366819..366862 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_179:367062..367159 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_179:367564..368019 (+ strand)
Length: 456
>GLEAN_52 class=GenePrediction position=GCSC_179:366706..368019 (+ strand)
ATGTCTGACCTGATGGACGCATACTTTCAGATGCCGCCTGTATCAAGGTACGCTCCAATCCTCATTGCCCTTCTCACTCT
CTCTTGACATCATCTAACTTGTCTCCTACTCAGGATACTCGCGACAGCTGTCTTTGTCACGTCTTGTGGCGTATACAGTA
GCATTATTCCAGGCCAATGGCTGTATTTCCATCAGGCACTTTTGTTCCGTATTCCACCCGGGATCTGGCGGCTTGTTACG
AGCTTTTTCGTCACGCAGCCACAGTTGTCGATCTTGTTGGACCCATACTTCCGTACGATACTGCCCTATCCACTACACTC
GAACAATAAGCAGTGATGCTTACTCTTTGCTTCCAGTCTACTCGTATGTCTCCCAGCTGGAAAAGGGCAACCCACGTTTT
GCAAAGCAAGAGGACTTAATATGGTATCTGGCATTCGTGTCTACTACTACTTTGGTAAGCTATACTCTTCGTGGTTTCCG
TTCATGTATCTTGATGCCTTTGTGCTTTTGTATATTTATATCTGTCGCGTCCTTTACACCTCATAATCTGCCCGGACAGT
GTTTGATCTCACCGCTGTCACGGTTCCTGAAATTGAGGGAGATTACCCCCTGGATTGCGGCCGGCCCGTCATTCGCTGAT
ATAAATATCAAAATGGGTCGGTCGGGGTCTTGGATATGGGTGGGATGTCTTTATGGATGGCTCGAAAACTCTATGGTTTC
CGAGCGGTTTTACAGCTCCCTACATCACAGTTGCCTGGTGCCACTGTGTGTTCATGTTTCAGTGTTGTTTTTACTATCGG
CCAAGCATGGATGGAGGTGATCACCTGCCTAGCATAATGCTGACTCTGGTCTCTCTAGATCTTTGATACAGCTCTCGGCT
TCAATTCCGGCTTCTACCTGCAGGGCCTGATTTTAGCCCTAGCGTATACCGTTACGCAGGATCAGCGTGGCATCAAGGCC
AACTTCTTCTTTGTCACCATACCAGCCCAGCTTGTGCCCTACGCTATGATGTTGGCGTCATTGCTCATGGTCGGCCCGGC
CGGTATCATGCTTCAGCTTTGTGGTCTGGCTGCTGCCCATCTGTACGACTTCCTGACACGGATTTGGCCCGAGTTCGGGG
GCGGTCGTAACTATTTAACCACGCCTGCTTTTGTCTCGCGCCTGTTAGTCCTGGCCTCACGTACCCAACAGCAGAGCTTT
GGCACTGCAATCCGTGGTGCCGGCACCGGTGCAGCAACAACAAGCGGAGGTGGAGGTCCTCTTCCAGATGCGTGGAGAAC
ACGGGGAAGAGGACAGCGTCTTGGCGGCGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62