GenePrediction:GLEAN_5300 Details

Name: GLEAN_5300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:576827..574896 (- strand)
Length: 1932
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:576827..576730 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_97:576639..576034 (- strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_97:575952..574896 (- strand)
Length: 1057
>GLEAN_5300 class=GenePrediction position=GCSC_97:576827..574896 (- strand)
ATGCCGGGCTCATCGCGGCTACCCGTCAGCATTGTGAACGGCTTCAACACCGTCCGTCGCCATCGGAGAAGCCCGTTTCT
GCTTCTCAACATCGACCTGTGAGTTGTGCTGTCTGCAAGAGGAGAGGCCAGGCGAGGAATGTCAGGTTGGCCAGAGTTTC
GGACCAACAAGGCTAACCTTATCCGCAGGATCCGCAATGCCGTCTTCTTCCTCTTCCTCCTCCGCCTCACCCGCCGTGCT
CTCTGGAAACTTCGCGGCTGCGGCATCTTCGGCACACTTGTCGAGCTGTACAATGACATCCGCCGTGTCCTCTTCGGCTG
GTTCCTCCGTATACCCAGCGTCCGGGACAAGGTCCGCCGCGAGGTCGACGAGACGCTCGGCAAGCTGGAGGCCAAGCTAG
TGCCCCTGAGTTCCATCCGCTACACCAAGATCCCGGCTAAGGGCTGGTCCGACGACCAGGTCCGCCGCGAGCTCGACGAC
CTGGCCGGCCTCGATCACACGCGCTGGGAGGACGGCCGGGTCAGCGGAGCCGTGTACCATGGCGAGGACGAGCTGATCAG
CCTGCAGACCGAGGCTTATGGCAAGTTCTCTGTAGCCAATCCGATCCACCCCGACGTGTTTCCGGGCGTGCGCAAGATGG
AGGCCGAAATCGTCGCCATGGTGCTCGGGCTCTTCAATGCGCCACCGGGAGCCGCGGGCGTGACGACGAGCGGCGGCACC
GACAGTATCCTCATGGCGTGTCTCAGCGCCCGCCAAAAGGGCTTTGTCGAGCGTGGCATTACAGAGCCGGAAATGTGCGA
TTTCTTCACCCTCTCTCTCTCTGTTCGCTGTCCGTTATTTTGTGCGCCCGCTGACCGTGTCCCAAACTGATACAGGATCA
TCCCCGAAACCGCCCACACAGCCTTCCACAAGGCTGCCCAGTACTACAAGATCAAGGTCCACATGGTTGCCGCTCCAGGG
CCTTCGTACCAGGTTGATGTGAAGCGGGTGGCGCGGCTGATCAACCCGAACACGGTGCTGCTGGTGGGCAGCGCCCCCAA
CTTCCCGCACGGCATCATCGACGACATTGCCGGACTCGGGCGATTGGCCGCGCGCAACAAGATTCCTTTGCACGTCGACT
GCTGTCTCGGCTCATTCATGGTGGCCATGCTGGAAAAGGCCGGCTTCGAGTCGACGCCGTTCGACTTCCGTGTGCGTGGC
GTGACCAGCATCTCTGTCGATACGCACAAGTACGGCTTCGCGCCCAAGGGCAACAGCACGCTGCTTTACCGCACTGCCAC
ACTGCGCAGCTACCAGTACTTTGTGTCGGCCGACTGGACAGGCGGCGTGTATGCATCACCCGGAGCGGCCGGATCGCGGC
CGGGTGCACTGATTGCCGGCTGCTGGGCGAGCATGATGTCGATCGGCGAGGCCGGCTACCTGGACGCGTGCGAGCGCATC
GTCGGCGCAGCCCACAAGCTGGCGGACCATGTGGTGTCGTCGCCGGTGCTGTCGCCCGAGCTGGAGGTCATGGGCCGGCC
ACTGGTGTCGGTGGTGGCGTTCCGGGCGCGGAAACCCAAGGCCGGAGCGGCGAGTGCGGGCCTACCGGCCACACCGCTAA
ATATATATGCGCTGGCCGACAACATGACGGCTCGGGGCTGGCACCTGAACGCGCTGCAGAACCCACCGGCGATCCACATT
GCGTTCACGCTGCCGGTGGTCAAGGTGGTGGACACGCTGATCGCAGACCTTGAGTCTGCCGTCGAGGAGGAGCGGGAAAA
GGCGCGGGTGCTTGCCGTCGAGAGAAAGAAGGCCGCTGAGAACGGCAAGCCGCTGCCGGCGGATCACAGTGGAGACGCGG
CCGCGCTGTACGGCGTGGCAGGCAGCCTGCCGAACAAGAGTATCGTCGTCGAGCTGGCGACCGGGTTTCTGGACCTGCTC
TACAAGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62