GenePrediction:GLEAN_5302 Details

Name: GLEAN_5302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:556008..553340 (- strand)
Length: 2669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:556008..555859 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_97:555796..553340 (- strand)
Length: 2457
>GLEAN_5302 class=GenePrediction position=GCSC_97:556008..553340 (- strand)
ATGCACGACATCACCATGAACGGCAACAGCACTATGTCGCTGGAAGACCGCTTCGAGGTGCTGAAGGAGATTGGCGACGG
CAGCTTCGGCAGCGTCGTTCTGGCTCGTGTGCGTAGCGCCGGGTCCAATGTCGCTCGCAGAGGAACTATTGTAAGTGGTT
GGACGAGCCGCTCTGCTGCCCCCTCCCCTGTTGCTAACCGTGCCGTCTGCAGATTGCCATCAAGACCATGAAGAAGACAT
TCCAGTCGTTCACGCCGTGTCTGGAGCTGCGTGAGGTCGTCTTCCTTCGAACCCTGCCGCCTCACCACCACCTCGTGCCT
GCTCTGGACATCTTCCTCGACCCCTACAGCAAGAAGCTTCACATCTGCATGGAGTACATGGAGGGGAACTTGTACCAGCT
GATGAAGGCGAGGGATCACAAGTGCCTCGACAACAGCAGCGTCAAGAGCATTCTCTACCAGATCATGCAGGGCCTTGAAC
ACATCCACGCCCACAACTTTTTCCATCGCGACATCAAGCCCGAAAACATTCTCGTCTCCTCGTCAAGCCACCAGGAGTCT
TCCAACTCGTTCCGCCGCTACTCCGCTCTGATGACACCGCCCTCCACGCCACCCACATACACCGTCAAGATTGCCGACTT
CGGTCTTGCCCGGGAAACCCACTCGAAGCTGCCTTACACGACCTACGTCTCCACCCGGTGGTACCGTGCCCCCGAGGTGC
TCCTGCGCGCAGGCGAGTACTCGGCACCGGTTGACATCTGGGCCGTCGGTGCCATGGCCGTGGAGGTGGCCACCCTCAAG
CCGCTCTTCCCGGGTGTGAACGAGGTCGACCAGCTTTGGCGTGTGTGTGAGATTATGGGCAGTCCAGGCAACTGGTACAA
CAAGGCGGGTGTCCGTGTGGGTGGAGGTGAGTGGCGCGACGGCTCGCGCCTGGCTGGCAAGCTGGGGTTCTCCTTTCCCA
AGATGGCACCCCACGCCATGGACACTATCCTCCAGTCACCGCAGTGGCCGGCTTCGCTCAGCCAGTTTGTCACCTGGTGT
TTGATGTGGGACCCCAAGACTCGGCCCACGTCAACCCAAGCTCTTGCCCATGAATACTTTTCCGATGCTGTGGATCCGAT
GCGGCCCAAGTCTTCTGCATCGCGGATATTGGGTCGCAAGCAGTCTGACATTGGCCGCAGCTCCAAGGATTCGTCCTCGT
CAACACCCGTTTCGTCCAAGCCGTCATGGTTCCGCAAATCGTTGATCGGTGGCCGCAACGATTCCGCTCTCGATGTCACG
GCCCCCAGCTTGAACGCGAAGGAGTCCGTTCCGTCTATCATCTCAATGGCGACTGCAGCTGCTGCGTCTGTGTCGGTGCA
GGTGGAAGCCCCGCATCCAGTCGCGGCAACACAAGTCCCGGCACCAGCGGCAGCAGTTCAGGCGTTGGCTTCGGCAGCAG
TCGCTCCGCGTCCTGCGCCTGTGCAGCAGGTGCCTGTCGAGTCGGGTATTCCAAAGGTGAGGGCAGCTGCTAGCAAGCGA
ACGACTTGGTCGAACGGGCCATCCAATGTGGCGCCGATGCCAATTCTACCCACCGTCCGTCCCATTTCTCCCGTGTCTGA
CGCTGTCACTGCCCAGGCAAATAACCGGACCCCAATGTACAACGATTCATACGCCAACAATGCGGCAACTCGGGTGGCTG
CAGAGGACAAGGCGTCCAAGAAAATTGGCCGGCAATTGTCCGTGGCATCGAGCACAAACCACTACGCAGATGTCCATCGC
CAGCAGGCAGAACAGGCCCTTACTGGCAACAGCGGCCTCGTATCTCCACCCAGTGCGCACAAGGAGAGCTTCTTCTCACA
CCTGCGAAAGCGGGCGCGTCGGCTCTCCGGACGTCACCAGACACCCATCACACCCGCATACGATGACGTGGAAGCACAGG
CTGGTTGTGGGCCATGGGCCAGCAACCGTTCGTCCATGGTGATTGACCAGCAGCATCAGGGTCCTGTACCCGCGCCATTA
CCCAAAGAGGGCACGCATGATCCTCAGGGACCACTGGGCTCTCTGCGAGAGGGCCACCAGAGCTGCTCCGGAGACAACAT
CAGCTACCTGCCGACGATCCCAGACAGTGCTCCTGCTGCAACAAGTCTGCACCAGTCGGCTTCGGTGTCCGGAGTGACGA
CGACGATCACGACAGGACTCGCGGGCGCTCACCTCAAGCGGCACCATTCACTACCCCATCATCAGCCGCGGTCAGTCGAT
AGCCTGCTCGTGGCGTCGCGAAGCAGTGGTGGCCCGATTTCAAGTCGTACCAGAAGGTCACAGGCAGTCCAAGGCGTGCA
CCAGTACGACGCGCCCGATGAAGAGGACGAACTCCTGGACGAAGTTCTCAATTCTACAGAGAATGCAGAAAAAAAGCTCG
AGAAGGTTGAGAAGATCGGGAAGATCGAAAAGCCAGCTCTACAGCAGTCTGCGAGCAATGCCAACACCTCAAATCCGTAT
CCGACGCCCTCACCTTCGGCCAGCGGAAACAACGTGCTCTACTCTGACGGAAAGGAAGCGGTGATGCCGAAGCCTCTGGA
TCTCAACAAGAAGACGGCGGACTACAAATGGCCGACTCCGCCGTATGACGAGAACGACTGGGCAGCATCAGCATCTGCAA
GCATATGGGCGGCAGGCAATCGAATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62