GenePrediction:GLEAN_5303 Details

Name: GLEAN_5303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:551875..549466 (- strand)
Length: 2410
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:551875..550812 (- strand)
Length: 1064
Type: CDS
Source: GLEAN
Position: GCSC_97:550743..550492 (- strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_97:550426..549466 (- strand)
Length: 961
>GLEAN_5303 class=GenePrediction position=GCSC_97:551875..549466 (- strand)
ATGAGCAACAATCCTCCGATGCGGCCGCCGCCTCCCGGACAGCGAAATCGGGACAAGCGCACCAACTACTATGCGACATA
CTCGCAAGGAGCAATACCGCCGCCACCACCGCCACCCCCTCGAAACCACGGGGCATCATCGACATCGTCGCTGCTGCTGA
CACCAGGAGGAGGAGGAGCAGCGGGGAACAGAGCCGGAGTAGAAGCAGGAGTAGGGGGGCTGACATCTGGGCTTGGCAGC
CTCGGGCTGGGACTGACGCCTGTCATGTCCAAGTCGGCGTCGGCCAGCAGTCTTGTTCCATCGTCAGCAGCAGCAGCATC
AGCAGCAACCGCAGCGATGCCCGGGACCAATCCGGTGTCGGCAGCCGAGGCGATCCACGGGCCCATTCGCGAGCCGGCAC
GCGAAACGGGGCCGGTGCCAGACCGGCTGATTGTCGGGGTGGACTTTGGGACGACGTTTTCGGGGGTGGCGGTGGTGTAC
TCGGCGACGCCGGACGATATCGAGATCATTAAGACATGGCCGGGCGGCAACGGGATCACGTCGGACAAGGTGCCGACGGA
GCTGATGTACGACCTGCCGGCCGATGCAGCCGCCGGCACGGAGCCGACGGTGCGGTGGGGCTTCCAGTTCAAGCCAGAGG
AGGCGCGGCTGCGCTGCATCAAGCTGTTCCTGGACCGGTCGCAGAAGCTGCCGTTCTACGTCAGCCCGCTCGAGACGGCA
GCGCAGCTGAGCCGCCACGGCAAGACGGTGGTGGACGCGGCGGCCGACTACCTCACGCAGGTGCGCCGTCACACGATAGA
CACGCTGGGCCGGCGCTATGGGGCCTCGTTCATGGCATCGACGCGCGTCGGTTATGTGCTCACCTGCCCGGCCGTCTGGT
CGGACGCGGCCAAGAACACGACGCTGCTGGCGGCCGAGCGCGCCGGCATGGGCGACCGCGCGGCCATCCAGATGATCAGC
GAGCCTGAGGCGGCGGCTCTGTACACGCTCAAGGCGATCCAGCCGAACCATCTGAACGTGGGCGACAATGTGATTGTGTG
TGATGGCGGCGGAGGGACGGTAGAGTGAGTTGTTTCTGTTCGTAGTCCTTGTCGTCCTCCTCGTCCCATCTCCCCCAGAA
CTAACAAAGTAGCCTGATCGCATACAAGATCATCTCGCTCAAGCCGCTGCACGTCGAGGAGTCAGCCGTGGGCACGGGCG
GCCTCTGTGGAAGCGCCTTCCTCAACTACCGGTTCGAGGAACACGTGCGCGAACGTCTCGGCGCCAGCCGGTTCGACGAG
ATGAAGGTCAAGAAGAGCAAGACTTGGCAGATGGGGCTGCGCTACTTTGAGGAGTTTGTCAAGCGCAATTTCAACGAAGA
CGAGCACCAAGAGGTGAATATTCCGTGAGTTTTCTATTTTGATCTCTCTTCTTCTCTCCTCTTTCCTCTCCACTCAAGCT
AATTTCTAGATTACCCGGTCTTCCCGACGATGAAGCAGTGGGCCTCGACTCGGGCTTCCTAGTCATGACTGCCGATCAGG
TGCGGGAAATCTTTGAGCCCGTGGTCACGGAGGTGTGCGATCTGGTGCAAGGCCAGGTCGACGGGCTGCGGTCCAAGGGT
GGCATCGTGTCGGGCATCATCCTCGTAGGCGGGTTCGGCCAGAGCGATTACCTGTACCGGCGGGTACGGGCATGCTTTTC
CGGCAGTGGCAGCGGAGCCGGTGATGGCGACGGTGAGGACGGCCGGCCCGGAGTGCTGCCTCCACCGCCATACAGTGAGC
GGCCGACACACGCAGTAGCGGCAGCAGCGGCAGCAGCAGAAGCAGCCATGACGACGTTGTCGACGCAGGCGGCCGGGCCG
ATCGAGGTGATGCAGCCGATGTACGCCTGGACGGCAGTCGTGCGTGGAGCAGTGCTGCGTGGACTCGAGGGCAACATGGT
GCTGTCGCGACGGGCACGTTTCCACTACGGCACGTCATACGCGACGGTATACGACGAGACCAAGCACGAGGTCGGCGAGC
GGTACTGGTCGCCGCTGTGGGAGCGGTGGATGGTGTCGGACCGCATGCAGTGGCACATTGCCAAGGACGACGCGATCTCA
CCGCTGGAACCGATCGCCTTCCACTACACGCGCAACTTCCGGCCGGGTCAGTCGCTGCTGGTCACCGATGACCTGCTGGC
CTGCGCGGCCGACGAGCCGCCTCTGGCCTACACACGCGGCCGCGACGCCAACCTGATACACGTCTGCACGCTCACGACCG
ATCTCCGGGCCGTGCCGCGCAGCCTGTTCACGCGACTGACCACAACGCGTGGCGTCGAGTTTGATAACCTCGACTTCACT
CTCGAGATGGTCGTCGACAGCGCCGGTCTGGGCTTCGAGCTCAAGGTGGACGGCGTGCGGTACGGCCGGGTGGAGGCAGA
ATTTCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62