GenePrediction:GLEAN_5308 Details

Name: GLEAN_5308
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:508687..505998 (- strand)
Length: 2690
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:508687..508419 (- strand)
Length: 269
Type: CDS
Source: GLEAN
Position: GCSC_97:508355..508140 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_97:508040..507949 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_97:507887..507643 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_97:507581..507344 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:507290..507269 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_97:507206..506707 (- strand)
Length: 500
Type: CDS
Source: GLEAN
Position: GCSC_97:506641..505998 (- strand)
Length: 644
>GLEAN_5308 class=GenePrediction position=GCSC_97:508687..505998 (- strand)
ATGGCGCCTGTCACGCCCGCAGCGGCTTCAGGTGCCCAGCCTGTCGACGCCGATGCCCTTCGCCGGCGTGCTGTTGTGCC
GGCGGTAGCTGTCGCTGCCCCAGTAGAAGCTGACGACAAGAAGAAGGCAACGAAGCCGCAGCTTTCGGCCTTGCAAATAC
TCTCAGACTGGGAAGTGGTCATTGCGCCGATCATCTTCACTGCCTTTGCCTTTTTCACTCGTCTCTACAAAATCGGCCTG
TCTGATATCGTCACCTGGGACGAGGCACAGTAAGCTTCAATTTTGTGTCCCTAGGTTGCTAAGACTTTGTGTTAACCATT
GGTCTTTGGCAGTTTCGGAAAATTCGGCTCTCACTATCTACAGCACACTTTCTACTTCGACGTGCACCCACCTCTCGGCA
AGCTTCTTGTCGGCTTGTCAGGTTACATAGCCGGGTACAATGGCAGCTTCGAGTTCAAGTCTGGCGAGACCTACCCGCCC
GAGGTCGATTTTTGGACCATGCGCGCATTCAATGCCCTCTTCGGCATTGCAACGATCCCCATGGCTTAGTACGCTCGACC
CTTCCCAAAAACTGCTATTGCCGTCCAGCCTTGACGTTTCTCGGCAAGCCTCGCATATGAAAATTGGGGTGCTAACTTCT
GGTGCAGCTTTACTGCACGGGAACTGACCTTCTCTCGTCCAGCCGTCTGGCTTGTCACCCTTATGGTTCTCTGCGAGAAC
AGCTACACCACTATTTCCCGTATGGGCTCTCCTCCGTACCGTCTCACCACCCCTTGACTTGGGTTCTAACAAGTTCGCAG
GATTTATCCTTCTCGATTCCATGCTTCTCTCAGGCACCATCGCAACCGTTCTGTGCTGGGCTAAGTTCCATGGCCAGCGG
AAGAACAGCTTCGAACCCGAGTGGTTCTTCTGGCTGTTTATGACTGGTCTGAGCATTGGATGCGTCACAAGCGTCAAGCT
CGTCGGCTTGTTCGTTACGGCCATGGTTGGCCTCTACACTGCTGAGGATCTGTGGAACAAGTTTGGAGACCTGAACATGA
AGCCGGTACGATATTGTTGGTGCCAAGAAAATCGAAATGGCGTCAGAATCTAACAACGGATTATAGGTGGTTCTTGCTGC
ACACGTCGCCGCCAGAGTGGTTGGCCTCATTATCCTTCCATTTCTCGTTTACCTGCTCAGCTTCGCCATTCACTTTGCCG
TTCTTACCCACTCGGGTCCAGGCGATGCTCAGATGAGCTCGCTATTCCAGGCGAACCTCGAGGGAACTGAGGTTGGCCAA
GGCAGTCCGCTTGAGGTTGCTTTCGGTTCGAGGGTCACTCTCAAGAACATGGGCTATGGTGGTGGTAAGTTTTGATCTCC
TGCTATGGACTATCCAACAAGCGCTCACACTTCTTAGGTCTTCTTCATTCTCACGTCCAGTACGGGAATCCTTCTTTTCC
ACGTCCACGTCCCCGCACTCGAAACTAACCTGCTTTGATAGGACGTACCCGGAAGGCTCTGGACAGCAGCAAGTTACTTG
CTACCACCACAAGGATGCCAACAACGAGTGGTTCTTCTACCCCACCCGCGAGGAACCCGAATATGACGAGAACGCCGAGC
CGCGTTTTGTCGGCGACGACTCTACGATCCGCTTGATCCACGCCCAGACCGGTCGCAACCTACACTCCCACGAGGTTTCA
GCCCCTGTGACCAAGGCAGACCGCGAGGTTTCCTGCTACGGCAACCTTACTGTCGGCGATGCCAAGGACTACTGGAAGAT
CGAGGTTCTGGATGACGTCGCTTCGCGCGATCACAGCCGCATCCGAACACTCACGACGTCCTTTCGCTTGAAGAACCCGG
TTATGGGCTGCTACCTTCGAGCAGGAAACGTCAACCTTCCCCAGTGGGGTTTCCGGCAGATCGAGGTCACCTGCACGAAG
GACAACAACCCCAGGGATACGTACACCCACTGGAACATCGAGGCTCATATCAATAAGAAGCGTAAGCTCCCCCTTTCTGT
GTCCTAGCCACCATCCAGGCGAGTCGAGTGATAATGACAGCCGCAGTACCGGAAGGCAACCCTGGCAGCTACAAGTCCCC
TTTCCTGCGCGACTTCGTTCACCTCAACGTGGCCATGATGACGAGCAACAACGCGCTTGTTCCAGACCCGGATAAGCAGG
ACGACCTGGCCTCTATGTGGTGGCAATGGCCCATCCTGAATGTCGGATTGCGCATGTGCGGCTGGGACGACAAGATTGTC
AAGTACTTCCTCCTTGGCAATCCCATCGTGTACTGGGGATCCACGGCAAGCTTGGGTATTTTTGCTTCGCTGGTCGCCTG
GTACGTGATCCGGTGGCAGCGAGGGTACACGGAGCTTTCGCAGGACGACATTGATCAGATCCACTATGCCGGTATCTACC
CAGTGATCGGCTGGTTCCTTCATTACCTGCCGTTCGTCATCATGGCCCGCGTCACCTACGTCCACCACTACTACCCAGCA
CTCTACTTTGCCATTCTCACGTTCGGCTTCCTGGCGGATTGGTTCCTCAAGAAGCGTGTTAAGACGATTCAGGCCGCGGT
GTACGGGCTTCTATATGCCACTGTCATTGGGCTGTACATCTTCTTCATCCCCATCTGCTGGGGCATGACGGGCCCCAACA
AGCAATATTCGTACCTGAAGTGGTTCGACGGTTGGCGGATTACAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62