GenePrediction:GLEAN_5309 Details

Name: GLEAN_5309
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:503011..500439 (- strand)
Length: 2573
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:503011..502999 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_97:502927..500439 (- strand)
Length: 2489
>GLEAN_5309 class=GenePrediction position=GCSC_97:503011..500439 (- strand)
ATGTTTTCAGAATGTGAGTGGCCGCGTCGCAACGTCTTTCTGTCTTTCTCTGTCTTCATCCCCTAATACGCTCTCGCCTT
GCAGATGCGTCCAAATTTCTGGCGCAGTCCCAGTCCAGGCTTTCCAGCTTCGGCCAGCCGGCGATAGCAGACGACGCCGC
CAGCCTGAATGGCTACAACACACACGCGACAGCCGGATCGGTGGCCGGTGAGCCCTCCAGCCGGCTGCGACCTGGGTCAG
ATTGGCAATCGTCTGCCCGCGGCCCGAAAGCCTTTGGACGGTCGTTTCTGAGCCGCGGCAATCCGTATCAGACGACAGGC
GGCTCGCGCTTCGGCCAGCTCAACTTTGCGTCACGCTACTCGGCTGCAGCCCAGGACGCGCCGCTCTTCCACAGCGGCCG
GGGCGACATCAACGAGGCGCTGGGCGAGGAAGACGAAGACGACGAGGACGAGATGGAGCGGGACCGAGAGGCAGCCGACC
TGTACGCGCTGCAGCGGTCACGGCGCGTGTTTGCGGCCAGCCGTCTGGACGAGAGCACCGGCACCGACAACGAGCGGAGC
CGAACGACGCTGGGGGACAGCCGCGGCGAAGATGACGACGAGGACGACGACGAGGAAGAGGAGCCCCTGACGGGAAGCGG
CCGGAGGACGACGAGGACGACAGCCGCAAATGGCTCTGGCGAAGAGGCTCGGGGAATCCAGAGCAGCTGGAAGGGCCGGC
CGGGAACACGGCAAAAGAGCCCGACAGACGGGCGGTCCGGCTACGGAATGCATGAGAGTCGGGGCAAGATGGTGGACATT
GGGCTGGAGTCGACGATTGCCGACAGCGAGCCGCCCGAAGACCTCACGTACGAGCGGCAGCAGCTTGACGACTTCGACGG
CGACCAGCCGCCGGCGTTCCAGCAGTTCAACCCGTCGTCCAAGGCCGGTCGGTTCGGGTTTCTCCACAACTCGGCGCACG
ACTCGGAGCTGGGGCTGCTCCACCGCCAGGACGTGGGCCGGGACACGGACAGCGAGGCGGCACACACGGCGGCGGTGGCC
GACAGCAGCACGCTGCACACGACGGCGGCTGCTGCAGCGACACCGTCGGACGGCGAGCTGTTCCGGCACGACCCGTTCTT
TGCGTGGATCTACCTGATCGCGGTGGCGTCGCTCTTTGCGACATTTGTGCTCGTGTACCTGCACACGTCGGTGCCGGACG
GCGGCGGGAAGCAGCCATGGGGAGACACCATTTACACGACGCTGCTGTCGTCGTTCCACCTGCTGGCCATCGACACGCTG
GTGGCCATCATCGTGTCGCTGGTGTGGCTGGCAGCACTGCGGTCGTTTGCGCGGCCGCTGGTGGCGGTGATGATCGTGGC
CGTGCCGGTGGTGCTGCTCTCGTTTGCCATCTACCCGTTCGTGTCGAGCTACCGGGGCAGCAGCGGGCTGCAAGACCGGG
TGATGCGATGGGCGTCGGTGGTGCCGGGCGTGGCGGCAATAGTGTGGATATATCTCGTGTGGAAGGGCCGGTCGGCGCTG
CGGTCGGCCGTGGATATTCTGGAGTTTGCGAGCCGGATCCTGGCAGCCAACTCAGCGCTGGTACTGGTGGGCCTCGGATG
CCTGACGCTGATCGTGCTCTGGACGTGGGCGTGGCTGGCCATGTTCACGCGGGTGTTCCTGGGCGGGTCGTTTTCGAGCA
AGCTGTCACGGTTCATCATCAGCGCGTCGAGCTGGTGGCTGGGCGCGTACTTTGTGCTGATGTACATCTGGACGCTGTCG
GTGATCTCGGGCGTGCAGCGCGGCACAACAGGCGCGACGGTGTCGCAGTGGTACTTCCATCGCAACGTGCAGCCGGCGCC
GTCGTCGGCCGAGGTAGTGTCGGCTGCGCTGCACCACGCGGTGACGACCATCTTCGGATCCATCTGCCTGTCGACGCTGC
TGGCGCTGGCGGTACGGCTGCCGCTGTTGGTGCTGCCGGGGCGGCTGGCCGATGCCGTGGGCCTGTTCTTCTACTCGCTG
GTGCCATCGTCGATCACGACGCTGACTAATCCATTAACGCTGACGTACTCGGCCATTCACTCGCAGAGCCTGACGGCATC
GGCACAGGGCCTGAGCCAGCTGGATTTTCTGTCGCCACAGGCGCCGACGACGACGCTGACGCCACGGGCCTTTCGGGGCG
GCCGACGGCAACGAGCACGACCGGGGACGTCGGCACCGCTGCTGCCGTACCGCCTGGCCAAGCTGCTGCTGCATGCGACG
CGCTTCATCATGGCGACAGCGCTCGGCTTTGCTGGCTGGGTGATGACGGCGCGGCAGCTGCGCATCCCGGCGCCGGACGG
GACTGGCAGCACGGTGCGCGGTAGCGCGTACGCATACGTGGTCGGGCTGGTGGCCAGCTTCATCGGCTGGGGCGTCTTGG
GCGCGATGGAGGGCACGCTCAGCGGCATCGTGGACGCGGTGGTGATCTGCTACGGCAGCGAGACGCGCATGGCCAACGGC
GGCGGAGGCTACTGCATGGAGGCCGCATACCTGTTTGGTGGGCGCAATAGCGGCGACAGGGACGAGACGTACCGACGTCA
TGAAGTGTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62