GenePrediction:GLEAN_530 Details

Name: GLEAN_530
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:421276..423687 (+ strand)
Length: 2412
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:421276..421339 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_97:421450..422565 (+ strand)
Length: 1116
Type: CDS
Source: GLEAN
Position: GCSC_97:422834..423687 (+ strand)
Length: 854
>GLEAN_530 class=GenePrediction position=GCSC_97:421276..423687 (+ strand)
ATGGCATCGACAACGCCTTTCACGCTCAGGTGGGGCATTCTGGCGACGGGGGGGATTGCCAAGGGTGAGTAGGGAGTAAG
AGAGAAGAGAAAGAGGAAGGAGAGAGAGAAGAAGGACGAAGAGAAGGTGGAGAGAGGAAAGAACAACAAGCTGACAGGCC
AGACTTCACAAAAGACCTGTTGACGGATCCGTCAGCGCGCGGGGCAGACGACGTGCGACACGTGGTGGCAGCAGCAGCAT
CGTCGTCGTCAAAGCAGCGAGCAGCGGACTTTCTGCACGCGGTGGGAGCCGGCGCCGAGGCGAAGGCCTACGGGTCTTAC
GCGGAGCTGGTGGCCGATGCCGACGTGGACATTGTGTACGTGGCGACGCCGCACAGCCATCACTTCCAGAACGCGATGCT
GGTGCTGGAGGCCGGCAAGCCGGTGCTGTGCGAAAAGGCCTTTACGGTGACGGCAGCCCAGGCGCGGAAGCTGGTGGCAA
CGGCGCGACAGAAGCGGCTTTTCCTCATGGAAGCCGTCTGGACGCGCTACTTTCCGCTGAGCGTGCAGGTGCGCGACCTG
GTGCGGCGCGGGGCCATCGGCACGGTGTATCGCGTGGTGGCCGACAACTCGATCCAGGCCAGCAGCACCGACGCGGCTAA
CAACCTGGTCTTTGCCGACGATCATCGCATGGTCGACATCCACCTCGCTGGTGGCGCTACGCTCGACCTGGGCATCTACT
CGCTCACCTGGCTCTTCCAGATCTTGTACCATCTGCAGCCGGACGCCGACGACGGGAAGGAGAGCCCGCGCGTGCTGGCT
GCCATGGACAAGTACCGCAATACGGGTGTCGACGAGTCGACCACGATGCTGCTACACTTTCCGCGTCACGGCACCACCGG
CATTGCCACATCGTCGATGCGCTTCGACACCGGCGTCGATGCTGCTCACCCGGCCGGTCCGGCCATCCTCATCCAGGGCT
CGGCCGGCGAAATCCAGGTGATCGGCTCAGCCTATCAGCCGCTGCAGTATCGCGTTGTCCGGAGACGTGTTGCAGCCGAC
GGCCAGCAGACAGCCACGACCGAGACCAAGACTGAGACTGAGACCGTCGACTGCCCCATCCCCCAGCCGGGCCGCGGCAT
GTTCTGGGAGGCCGACGAATGTGCCCGCTGTCTGCGCGATGGCCGGCTTGAGTCCGAGACGCTGCCGCTGGACGAGAGCA
TCGTGATCATGGAGACGATGGAAGAAGCACTGCGGCAGGGTGGGATTAAGTATCCAGAGCTGATCACGTCGGACGTCTAC
TCTGCGGACAGTCCGTTGAACAAGGGGAGGTCGTAGGTTTGGGCAGACGAGCGAGGAGGTGGGAGAGGAGACAATAATGA
CGAGAGCGACGAGAGCAGAGAATACAAACAGACGAGAATACGAAAAAAGACAATACGAGTACTCCGTAGTCCTACAATGA
GGGCTGTTGCCTTTTCTGGCAATTCCGCGAGATCCATTTTAATAAGCGGGGGTTTATAGCCCCACCAGACAGCCTTTTCT
GCCCTTTTTGGTTTTGCTTGCTTTGGGGATTTGGAAAGCCAAGGGAAAGACGACGATGACGGCATCGGGCGAGTCAGCGG
CGGCGTACGAGCAGGCCCACGTGCACGAGGTGTACGATGCAATTGCCGACCATTTTTCAGCGACCCGCTATGCGCCCTGG
CCGCTGGTGGCGCAATTCCTGGCCGCCCAGCCGCCGGGCAGCATTGGATTGGATGCCGGCTGCGGCAACGGCAAGTATCT
GAGCGCCGGGAGGGAGAGGATGGCCGGCGGTGAGGAGAAGGCGGCCTGTTTTTTCCTGGGCAGCGACCGCAGTGCCGCGC
TGGCCCGGTTGGCCTACGACAAGCACGGCCGCGGGCGTCCAGGCGCTGACGTCGTGTTGGCTGACTCGCTGGCCTTGCCA
TTCCGCGACGGCTGTGCCGATTTTGCCATCTGCGTGGCCGTGGTGCACCACCTGTCGACGCGGACACGGCGGCAAGAGGC
CGTGGCGGAGCTGCTGCGCTGTGTTGGGGGGGAGAGACGCTGTGATGGAGGGACGAGAGAGACGACGGCGGCGAATGCAG
AGGCGAAAAGGGGGACGAAAACGACAGACACGAAATCCACACACACAGGTCGCGTTCTCCTCTACGTCTGGGCCCTCGAG
CAGGCGTCCAGCCGGCGTGGCTGGTCGGCTGGCGGCGAACAGGACCTGCTGGTGCCGTGGGTCAAGACATTGCGGCAGAA
GAAGACGGAAGACGGGGACAGGACGACACGACGGCCGACTTTTCAGCGCTACTACCACCTCTACCGGGAAGGCGAGCTGG
AAGAGGACGTGCGGGCGGCTGGCGGCCACGTGGTCTCGAGCGGCTACGAAAAGGACAACTGGTGGGTCATAGCCGATGGG
ATGAGGGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62