GenePrediction:GLEAN_5310 Details

Name: GLEAN_5310
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:499661..498534 (- strand)
Length: 1128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:499661..499573 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_97:499524..498534 (- strand)
Length: 991
>GLEAN_5310 class=GenePrediction position=GCSC_97:499661..498534 (- strand)
ATGTCTGAATTCCAGGCCCCGACCGGGCCGCCACCTCCCAAGGTGCCTGATGGCTGGGTGGCCCGCTGGAACGACCAGTA
CAAGGAGTGGTAAGTCGAGTGTTTGTTCGTCTGTGCCCCATTTCGGCTGACAGCCAGGTTCTATGTGAACACGTACACCA
AACAGTCCCAATGGGACCGGCCGACGGCGCCGGCCCTCGTGCCCGGTGGAGACGCTCCCCAGGGACCTCCGCCGAGCTAC
TCGCCCAGACCGGGTTCGAACACCGGCGACGCCAAGAAGAATCCTTACGGTGGCGACGGAGGCCGCCAGGGCTCGTGCAG
CCCTTGCCACCACCACGAGTCCGACGATGAGCGCTATGCGCGGCGCCTGCAGGAGGAAGAAAATGCGCGAGCTCGCGCTG
GTGGTGCCGGCAGTGTCGGTGGTGGTGCGGCGGCCTCGTATCTGAACTCGCCGCCGGCGCCGGCCATTCCGGCCCGGCCT
GTGAGCAGCGGTCCCGGATCAGCAGCTGCTGGAGCAGCCGTTGGCGGAGCCGCCGGAGCAGCTGCCGGTGCTGCCGGCTC
GCGCGGTCTCCTCGGCAAGATCTTTGGCGGCAGCAAGAAGCCACAGTACGGCGGTGGCGGTGGCGGCTATCCCGGCCAGG
GCTACGGACCACAGGGCGGCGGCTATGGCGGCGGGGCTCCCCAGCAGGGCTACGGCCAGCCGGCATACGGCCAGCAGGGC
TATGGCCAACCGGCATACGGTCAGCAGGGCGGCTACGGCCAGCCGGCGTATGGCCAGCCGGCGTATGGGCAGCAGGGCGG
CTACGGTCAGCCGGCATATGGGCCGCCGGGCGGCTATGGCCAGCCCGCCTACGGCCAGCAGGGCGGCGGCGGATACTACC
AGCAGCAGCAGCAGCAGCAGCCGCCGCGGAAGTCAGGCATGAGCACGGGCGCGGCAGCGGCGCTCGGCGTTGGCGGCGGC
CTGCTGGGCGGCGTGCTGCTGGGCGAAGCGCTGGACGGCGGTGACGGCGGTGGCGATGGTGGCGGTGACGGCGGCGACTG
GGGTGGCGGTGGCGGCGATGGCGGTGACTGGGGCGGTGGAGGCGATGGCGGCGGCGACTGGGGAGGCGATGGCGGTGGCG
ACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62