GenePrediction:GLEAN_5311 Details

Name: GLEAN_5311
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:492169..489879 (- strand)
Length: 2291
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:492169..491746 (- strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_97:491694..490104 (- strand)
Length: 1591
Type: CDS
Source: GLEAN
Position: GCSC_97:489981..489879 (- strand)
Length: 103
>GLEAN_5311 class=GenePrediction position=GCSC_97:492169..489879 (- strand)
ATGGCGCCCGCCGACGCTTTAGCCTACATGAGCAAGCTCTCGTCGCCTCCGGAACCAGGCGCGCCCTTTGCCGTCACCAT
TCCCGGCAGCGAGACGCCGAACCGGACGGCTGTCTACCGCAATTTTCGATTCCGCGACTCACCCCTGCTCGAGACGCTCG
ACCCGACCGTGCGCACGCTGCACGATGCCTTTGAGAGTTCGGCCACGTACCGGTCGTCGAAACAGATGCTCGGCTGGCGA
CCCTGGAACGTAGCCAAGAAGACATGGGAGCCCAAGTATCTGTGGATGACGTACGCCGAGGTTGCGGAGCGGCGCAAGAA
CTTTGGCGCCGGCATCGTCGAGCTGCACAAGCAGATTGGCGTGACCGACGACAAGTACGGCGTGGGCCTCTGGTCGCAGA
ACCGACCGGAATGGCAGATTGCTGGTTTGTTTACCCTCTTTCCTCTTTCCTTTTTCCTCTTCTCTAACCTGTCAGAACTC
GGCCTGATGTCCCAGTCCCTCTGGAACGTGTCGCTTTACGAAACGCTCGGCCCCGACGCAACGGAGTACATCATCAACCA
CGGACAGCTGGTGTGCGTGATCGCGACGCTGCCACACATTGCGACGCTGCTGAAGCTGGGCCCACGTATCTCGTCAGTCA
AGCTGATTGTGTGTATCGACGCGCTGGACTCGGGCGAGCCGAGCGGGTACTCCAAGGGGGCGCTGCTGCGCGAGCTGGCT
AGCGAGCAGGGGGTGCAGATTTACTCGATGGCGGAGGTGGAGGAGATTGGGGCGCGGTCGGGACGGACGATACGGGCGCC
GGCCAAAGAAGACATCACGACGATCAACTACACGTCGGGCACGACGGGTGACCCCAAGGGCGTGGTGCTGACGCACGGCA
ACATGGTGGCGTCGACCAGCTCGGCACGGGCGTCGGGGTTCATGTCGCCCAACGACACGCACATCTCGTATCTGCCACTG
GCACACATCTACGGGCGGATGGCAGACTGGAGCGCGATCTCGTTGGGAGCGCGAATTGGCTACTTCCACGGCGACATGAC
GCAGCTGGTGGAGGACCTGAAGATCCTGCGGCCGACGGGGCTGTTTTCGGTGCCGCGGCTGTACAACCGATTCCACTCGG
CGATCCAGGCAGCGACGGTGGAGGCGAGCGGCGTGGGGGGTGCGCTCTCGCGGGCCGCCGTGGCGGCCAAGATGGCGAGC
ATGCAGCAGAAGCCGGGGCAGGCGACGAACTGGCACCCGGTGTACGACCGAATCTGGTCGCCCAAGGTGCGGCGGGCGGT
GGGCCTGGACCGGGCGGTGGGCATGGTGACGGGCAGCGCGCAGCTGGACCCGGACGTGCAGCAGTTTCTGCGGGCAGCCT
TTGGGATCGCCTTTGTGCAGGGCTACGGCATGACGGAGACGAGCGCGGTCGGGAGCGTGCAGGTAGGCGGCGACTTCAGC
GTGGGCAACATTGGGGGACCGCAGCCGGGCGTGGAGTTTTGCATCGAGTCGGTGCCGGACCTGGAGTACACGGTGGAGGA
CCGGCCGAACCCGCGGGGCGAGCTGCTGATGCGAGGGCCGATTGTGTTCCGCGAGTACTTCCGGAACGAGGCCGAGACGG
CGCGGGTAGTCGATGCCGGCACCGGCTGGTTCCACAGCGGCGATATTGTCGAAGTCGATAGCCTGGGCCGTTTCAAGATC
ATCGACCGCCGGAAGAATGTGCTGAAGCTGGCCCAGGGCGAGTACGTGTCGCCCGAGCGGATCGAGAACGTGTACATTGG
CGCGCTGCCCGTCGTCGCCACCGCCTTTGTGCACGGCGACGGCATCGAGGCGTCGCTGGTGGCCGTGCTGGGCATCGAGC
CCGACGCCTTCGCCCCGTTTGCCAGCAAGCTGCTGCACGAGCACATTGTCGCGTCCGACGTCGAGGCGCTGCGCCGGGCC
GTCCGTGATCCGCGCGTCCGGGCCGCCGTCCAGAAGCAGGTCGATGCCGCCGGCCGGAAGCACAAGTTCAACAGCTTTGA
GCGCGTGCGCAGCATCTACCTGGCCGTGGATCCGTTTACGATTGAGAACGAGTTGCTGACACCGACGTGAGTTTGAGTTC
TTACGCTTTTTTTTCTTTTTTTTTCTTTTTTTTTTCTTATCTTCTTCGTATCTTCTTATTTTTCTCTTCTTCTTCCGTTC
CTTCTCCTCTTCCTCGCTAATAATACAGTCTTAAACTCAAACGCCCACAAGCGGCCAGAGCCTTCCGAAAGGAGATCGAC
GAAATGTACGCGGAGATAAAGGCCCTAGAGACAAACCGGGCCAAGATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62