GenePrediction:GLEAN_5313 Details

Name: GLEAN_5313
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:479893..478256 (- strand)
Length: 1638
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:479893..479774 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_97:479699..479635 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_97:479548..478611 (- strand)
Length: 938
Type: CDS
Source: GLEAN
Position: GCSC_97:478554..478256 (- strand)
Length: 299
>GLEAN_5313 class=GenePrediction position=GCSC_97:479893..478256 (- strand)
ATGGCTTCTGCTATGCGCTTGAGCTCCAATGCTCTGCGGATGTCCCTGCGGACATCGTCCGCTTTCGGCGCCCGCAACAC
TGCCTTCAGTGCTGCCCGCTGCTACTCGGCCAAGACCCAGGTAAGCCAGCACGGCCTGGCGACGGTGGTATAAGAGAAGC
AAGGCCGCCAATGCAGAGCTGACAGCCGTTGCAGACCCTGAAGGAGCGCTTCGCCGAGCTTCTGCCAGAGAAGATCGATG
AGATCAAGTCGTTCCGCAAGTACGTCCATCCGTTTGTCCGAGTCGCCATGGCAACATCAGCCGGCTGTGAAGGTGTATGT
GTGCTGACCATTGGCCCGTCTGTAGGGAGCACGGCAACACGGTGATCGGCGAGGTCACGATCGACCAGGTATACGGCGGT
GCCCGCGGCATCAAGTCGCTCGTCTGGGAGGGCTCCGTCCTGGACCCCGTGGAGGGCATCCGGTTTCGTGGCAAGACGAT
TCCGGAGTGCCGCGAGGTGCTGCCCAAGGCAGTCGGCGGCACAGAGCCGCTGCCCGAGGGTCTCTTCTGGCTGCTGCTGA
CGGGCGAGGTCCCGACGGAGCAGCAGGTGCGCGACCTGTCGGCCGAGCTGGCCGCTCGCTCGGACGTGCCCAAGTTCGTC
GAGGAGCTGATCGACCGCTGCCCGACCGACCTGCACCCGATGGCGCAGTTCTCGCTGGCCGTGACGGCGCTCGAGCACAA
CTCGTCGTTTGCCAAGGCGTACGCCAAGGGCATCAACAAGAAGGAGTACTGGGGCTACACGTACGAGGACTCGCTGGACC
TGATCGCCAAGCTGCCCACGATTGCCGCGCGCATCTACCAGAACGTTTTCAAGGGCGGCAAGGTCGCCGCGGTCCAGAAG
GACCAGGACTACGGCTTCAACTTTGCCAACCAGCTCGGCTTCGGCAGCAACACCGACTTTGTCGAGATGCTGCGTCTGTA
CCTGACCATCCACTCCGACCACGAGGGTGGCAACGTCAGCGCCCACACTACCCACCTGGTCGGCAGCGCCCTGAGCTCGC
CCTACCTCTCGGTGGCCGCTGGCCTGAACGGTCTGGCTGGCCCGCTTCATGGCCTGGCCAACCAGGAGGTGCTCAACTGG
CTCACCGAGATGAAGAAGGCGATCGGCGACGACATCAGCGACGCCAAGATCACCGAGTACCTGTGGGCGACGCTCAACAG
CGGCCGTGTCGTGCCGGGCTACGGCCACGCTGTGCTCCGCAAGACGGACCCTCGCTACACCGCCCAGCGCGAGTTTGCTC
TCGGTACGTGGAATCCTGTTTCAGTTTGTCCTGTCTCGCCCCCGCTAACGCCCCTCTAGCCAAGCTGCCGGATGACCCCC
TGTTTAAGCTGGTCAGCCAGGTGTACAAGATCGCCCCTGGCGTCCTGACCGAGCACGGCAAGACCAAGAACCCGTACCCC
AACGTCGACGCCCACTCTGGCGTGCTCCTGCAGCACTACGGCCTGACCGAGTCGAGCTTCTACACCGTCCTGTTCGGTGT
GTCCCGCGCCATTGGCGTGCTGCCGCAGCTGATCATCGACCGCGCCGTTGGTGCCCCCATTGAGCGGCCCAAGTCCTTCT
CGACTGCGAAGTACATTGAGCTGGTCAAGAAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62