GenePrediction:GLEAN_5314 Details

Name: GLEAN_5314
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:476646..475568 (- strand)
Length: 1079
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:476646..476421 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_97:476358..475686 (- strand)
Length: 673
Type: CDS
Source: GLEAN
Position: GCSC_97:475622..475568 (- strand)
Length: 55
>GLEAN_5314 class=GenePrediction position=GCSC_97:476646..475568 (- strand)
ATGTCTGCCGTCCCTGTCGCCGCCGCCGCCGGCGCCCCCGTTGCTCTGCCGGAGAAGAAGCCGGTCAAGTTCTCGAACCT
GCTCCTCGGCGCCGGCCTCAACATGTTTGAGGTCACCACGCTCGGCCAGCCGCTGGAGGTCACCAAGACCACCATGGCCG
CCCACCGCGGCGACAGCTTTGCGGGCGCCCTGGGCCGCATCTGGGGCCGTGGTGGCGTTCTCGGGTGTAAGTGAACTCGC
GCTCGCGTCCCAGCGTCTCTTCTGCCCCATGCTAACTGACCCCCGCAGTCTACCAGGGTCTCATCCCGTGGGCCTGGATC
GAAGCGTCCACCAAGGGCGCGGTCCTGCTGTTCGTGGCCACGGAGGCGGAATACTACGCGCGTGCGGCCGGCGCTTCTGA
GTTTGTCGGCGGCATCGCCGGCGGCGTCACCGGCGGCGTAGCCCAGGCCTACGCCACCATGGGCTTCTGCACCTGCATGA
AGACGGTCGAGATCACCAAGCACAAGATTGCGTCGTCGGGCCAGAAGGCGCCCGGCACGTTTGCCACCTTTATGGACATC
TACCGCCGCGAGGGCATCGCCGGCATCAACAAGGGCGTCAACGCGGTGGCCATCCGCCAGATGACCAACTGGGGCTCACG
TTTTGGCCTGTCGCGCCTGGCCGAGCAGGGCATCCGCCGCGTCACCGGCAAGGAGCACAACGAGAAGCTGGCCGCGTGGG
AGAAGATCCTGGCCAGCGGCCTCGGCGGCGGCCTCAGCGCCTGGAACCAGCCGATCGAGGTCATCCGCGTCGAGATGCAG
AGCAAGACCGAAGACCCCAACCGGCCCAAGAAGATGACCGTTGGCAACACCTTCCGCTACATCTACGGCAACAACGGCGT
GCGTGGCCTGTACCGCGGCGTCGCCCCGCGCATCGGGCTCGGCGTCTGGCAGACCATCTGCATGGTGGCCCTCGGTGACA
TGTGCGTGTTCTCTACTTTCCGCTCGCCGTCCATTTTACCGGTCCTCTTGCTAACCTCGTCCAGGGCAAAAACCTATGTC
GAGAAACTGACCGGCGAAAAGGTCACGGCAAAGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62