GenePrediction:GLEAN_5315 Details

Name: GLEAN_5315
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:471581..470967 (- strand)
Length: 615
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:471581..471391 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_97:471132..470967 (- strand)
Length: 166
>GLEAN_5315 class=GenePrediction position=GCSC_97:471581..470967 (- strand)
ATGGCCGGATTGGTCGGTGTTGTCTGGCACGACGCCATGCTCTGGCTGCTTGCGGCATTCAGCAAGGGAATCGGAGCAGA
CGTGAGCGGATGGCCGGCCGGCGGAATTTTTCCCTTTTCCTCCTACACCGACGACAAGGACGGCCTGGACGGATCCGCAA
AAAGGACCACGTCCAAGATTCGTACTACGACGTATGTAATAGTGGTGTTCTGCAGACAGCTGGTCGTGCACACTGTGAGG
AAATTTGGCCAGCAAGGAAAAGTCGGTCCTCTAGCTCTGTTTTTTTTATGATTTTTTTTTGGGGTTGTTTTTCGTATTCT
TTCTTTTGGACTTCCTCCCGCCGGTATAGTAGGCCTTTTTTTAACTGGAGCTCGCCTTTTCGCTTCTTGACATTAAGCCC
GGTTGCCGTGGGTGTGTCTATTGCATCGTTTTTAGTGGAGCCTCCGTAGTGTATCACAGGCAATGCCGACCTCCGACCGT
CGCACGGAGTTGGGTACAGTAGCCTTCACCATGGAGATTAAGGCACGCGAGGCTTTTCCCGAAGGGAGAGGCAGGAAGTC
GGCCCAAACACCGATGGAGTCTCGCTCCCCTGCCGCGTTTTCGTCATCGTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62