GenePrediction:GLEAN_5316 Details

Name: GLEAN_5316
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:466443..463382 (- strand)
Length: 3062
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:466443..466145 (- strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_97:466082..465992 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_97:465813..463485 (- strand)
Length: 2329
Type: CDS
Source: GLEAN
Position: GCSC_97:463428..463382 (- strand)
Length: 47
>GLEAN_5316 class=GenePrediction position=GCSC_97:466443..463382 (- strand)
ATGGCGGACTCAACGTCACACGCGCCTGCTCTGCAGACGAATATACCGGGCGGTGGCTTCGACGAGAAGTCAGCTGCACC
TCCCGCCCAGGCTTCGAAGCCCAAGGTTGAGGATGATGAGGATGAGGACATCGATGCCCTGATTGAGGACCTCGAGTCTC
ATGATGGACACGGTTTGGAGGAGGACGATGAGGACGAGGCTGCCCAGCCGGGCGGTGAACGTATCATTCCTGAGGAGATG
CTGCAGACCGATACCCGTATCGGTCTGACTGATCAGGAGGTCGTTGCTCGTCGTCGCAAGTACGTATTGATCCATTGCTT
CTCAATTGTTATCGCAGGAGCCGCATATTGACACCCTACAGGTTTGGTCTGAACCAGATGAAGGAGGAGAAGGAGAACTT
GGTCCTCAAGTTCCTCGGCTTCTTTATCGGTCCCATCCAGTTCGTTATGGAGGTAAGCTTTCGATCCTAGAAAAATGCCT
CAGCACGGTTGCCGGGCTGTTTCCAATTGGTGGATCTAGTTTTCTGGAGTTTGTACCCACTATAGGCTGCAAGCCAGGGA
TAGCGGAGAAAAACTTGTTTCTGATTCTTGATCGGCCGATTGGACCCCATAACTAACGATACTTTCTTAGGCTGCTGCTG
TTCTTGCTGCCGGTCTTAAGGATTGGGTCGATTTCGGTGTCATTTGCGCTCTGCTTCTGCTCAACGCCTTTGTTGGTTTC
ATCCAGGAATACCAGGCTGGTTCTATCGTCGACGAACTGAAGAAGACTCTCGCTCTGAAGGCTGTCGTTCTCCGTAACGG
CACGCTGCAGGAGATTGAGGCACCTGAGGTTGTTCCCGGTGATATCCTTCAGGTTGAGGAGGGTACCATTATCCCCGCTG
ATGGTCGCATTGTGACGGAGGATGCCTTCCTCCAGGTTGATCAGTCCGCTATCACGGGTGAGTCGCTCGCTGTCGACAAG
CACAAGGGCGACCAGTGCTACGCGTCTTCCGCTGTCAAGCGTGGTGAGGCTTTCGTCGTGATCACCGCCACTGGTGACAA
CACCTTCGTCGGTCGCGCTGCTGCCCTGGTCAACGCTGCTTCGGCTGGTACCGGTCACTTCACTGAGGTGCTCAACGGTA
TCGGTACCATTCTGCTGGTCCTGGTCGTCTTCACTCTCTTGATTGTCTGGATCTCTTCGTTCTACCGGTCGAACCCGATT
GTCCACATTCTGGAGTTCACTCTCGCTATCACTGTCATTGGCGTGCCCGTCGGTCTGCCTGCTGTCGTTACCACCACCAT
GGCTGTCGGTGCCGCTTACCTCGCCAAGAAGAAGGCTATCGTGCAGAAGCTGTCGGCCATTGAGTCGCTGGCTGGTGTCG
AGATCCTCTGCTCTGACAAGACCGGTACTCTGACTAAGAACAAGCTGTCTCTGGCTGAGCCGTACACTGTCGCCGGTGTC
GACCCCGAGGATCTGATGCTTACTGCCTGTCTCGCTGCCTCACGCAAGAAGAAGGGTATCGATGCCATCGACAAGGCCTT
CCTCAAGTCGCTGAAGTACTACCCGCGTGCCAAGAGCGTTCTGTCCAAGTACAAGGTTATTGACTTCCACCCGTTCGACC
CCGTCTCCAAGAAGGTCCAGGCTCTCGTTGAATCTCCCCAGGGCGAGCGCATCACCTGTGTGAAGGGCGCCCCGCTGTTT
GTGCTCAAGACCGTCGAGGAGGACCACCCCATCTCTGAGGAGGTTGACCAGGCCTACAAGAACAAGGTTGCCGAGTTCGC
TACCCGTGGTTTCCGCTCTCTCGGTGTTGCCCGGAAGCGTGGTGAGGGTTCTTGGGAGATTCTCGGCATTATGCCCTGCA
TGGACCCCCCTCGTCACGATACCGCCCGCACGATCAACGAGGCCAAGTCTCTGGGTCTGTCCATCAAGATGCTTACTGGT
GACGCTGTCGGTATTGCCCGCGAGACTTCTCGCCAGCTCGGTCTCGGTACCAACGTCTACAACGCTGAGCGCCTTGGTCT
TGGTGGCGGTGGTGACATGCCCGGCTCTGAGGTTTACGACTTTGTCGAGGCTGCCGATGGTTTCGCCGAGGTTTTCCCCC
AGCACAAGTACAACGTGGTCGAGATTCTCCAGCAGCGTGGCTACCTCGTTGCCATGACTGGTGACGGTGTCAACGACGCC
CCGTCTTTGAAGAAGGCTGATACTGGTATTGCTGTCGAGGGTGCGTCTGACGCTGCCCGTTCTGCTGCCGACATTGTGTT
CCTTGCTCCTGGTCTCGGTGCCATCATCGATGCGCTCAAGACTTCTCGCCAGATTTTCCACCGCATGTACGCCTACGTCG
TCTACCGTATCGCTCTGTCGATCCACCTGGAGATCTTCCTTGGTCTGTGGATTGCCATTCTCAACCGTTCGCTGAACATT
GAGCTGGTCGTCTTCATTGCCATTTTCGCCGATGTTGCTACGCTGGCCATTGCCTACGACAACGCTCCCTACTCCAAGAC
GCCTGTCAAGTGGAACCTGCCCAAGCTCTGGGGTATGTCCGTCCTTCTTGGAATTGTCCTGGCTGTCGGCACATGGATCA
CTGTCACGACCATGTACGCCAACGGCGAGAACGGTGGTATTGTCCAGAACTTCGGTAAGATGGATGAGGTCGTGTTCCTT
CAGGTGTCTCTGAGTGAGAACTGGCTGATCTTCATCACCCGTGCAAACGGTCCGTTCTGGTCGTCCATCCCGTCGTGGCA
GCTGTCTGGTGCCATCCTGGTCGTCGATCTGCTGGCCACCTTCTTCACTCTCTTCGGTTGGTTCGTTGGTGGTCAGACCT
CCATTGTTGCCGTCGTCCGTATCTGGATCTTCTCCTTCGGCGTGTTCTGTATCATGGGTGGTCTGTACTACATGCTCCAG
GACAGCGTTGGATTCGACAACCTTATGCACGGCAAGAGCCCGAAGGGCAACCAGAAGCAGCGGTCCCTTGAGGACTTTGG
TAAGCATCCTCCTCCTGAGTCTTTTGTATGACTGCATCCACTAACTCCTTTATAGTTGTGTCTCTGCAGCGTGTGTCGAC
CCAACACGAGAAGTCGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62