GenePrediction:GLEAN_5317 Details

Name: GLEAN_5317
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:462740..460646 (- strand)
Length: 2095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:462740..462704 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:462616..462137 (- strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_97:462062..461996 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_97:461930..460646 (- strand)
Length: 1285
>GLEAN_5317 class=GenePrediction position=GCSC_97:462740..460646 (- strand)
ATGCCTGCACCGTTTGAGCTGCCGGGCTACCACTGGGGTGAGTGCCAGAGTGTCTGATGGTGATGCTTACCTGGGAAGCC
CCGTTCTGATTGTTCTTGTCTTGCTCACCTCTCACCTCTCGCAGACGAGTCGCGCCAAAAGTTTTTCAAGACCGAGAGGA
CGGCGACGGCGCCGACGGGCGCCAGCTGGGCGCAGGCCGAGGTGCGCCACCGCCAGCAGCAGGACGAGCAGCGCAGCGGC
TGCAAGCGGCGGCGGGTAGAGGGAGGGGGTCATGGTCGTGATCGTGATCGTGGTCAAAGTCAGGGCGATCCACCACCACC
GCCCATCGTGCGGGCGCCCGTGTTTGGCCGCCTCTCGGTCCTGCTGGAGCGGCCGCTCGACCGATCCGCGCCGTCGGCAT
CATCATCGTCGTCGCCGCTGTCGGTGGCCGCCGCGGCCGTCGCGCGTGGGCTCTGCTATCGCGGCCAGGTCGACTGCAGC
AACAGCAGCGGCGGCGACCCCGAACGCGATCGCACCAGGGTGTCGTGTCTGTACGTGCATGACGACGACGGCACCAGCGA
CGGACAGAACCCATGGCCGGACGCGATGGGGGTTCTGTACACGAGTGCGTACTGTTTTTTCGCTTCTTTTCGCTTCTTTC
TCGGTCCTCTCTTTTTTTTCATATGCTGACTCATCAAGACTGCCCTCGTCCCGATGGCCGGTCCGATGTCCGGGCCCAAT
ACATTCCCCGAGACGACCGCGGCTTGTGAGTTTTTGGCTTAGAGGTGTCTGTGGCTCGTGTAGACAGCTGATCGGCTTCC
TTTTTTGCAGCATCCCCTCCCTCTGGCCGACCGAGGGTTCTCTTGGCCGCCTCCGCCATCTCGAGAGCCCCCATCTCGAA
GGTCTGGACGTGCCCGACGCCTCGGCCATCTGCTATGCGGCGGCCTCACGACAGCTGATCGTCACATCGCGCCGCCTGGC
CGAGGGCCGCCGTATCGTGCGCGCTCCGGGTGTCGAGCGTTCCGACGGCATCTGCATGCACGTGATCGTCCCATCGGCTG
AAGAGCGGCCTCGCGGCGAGTCTCGCCATCCCGACAACCTCGCCCACGTATATGGAAACGGGGCGCAGGATGCCGTTTAC
GGCTGCGCGGCTGCTCCGTCGCCTGCGTCGAGCGGTATGCTCTGTGTCGTCGGGGCCGGCCGTGGTCTCGCGCTGATCAA
CGGCGAGCGGCTGCGACGAGGCACCATGACGGCGGCAATGGGTGCTGGCGGCCTCGGACGGCGACGCACTGCCGGTCTCT
TCCTGTCTGACTACCAGATCGGCACACCGCCTGCAGACGAGGAGTCATCGTCGTCCATCGTCACGGCCGTCGACTTTCTC
GATGGCCATCCGCAGCTTGTCCTCGCCGGCGGCCGGCGGCCGCATCCGTGGATCGTCGATTTGCGCCAGGGACAACATCG
ATCCTGGCACTCGCTCCGAGGCGATGCTGGCTGCAGCCCCGACGGTGAACCCCAGGTCACCAATGCCATCGCCCATGTCC
GGTCGGCTGGCAGCCATCGTGTCGTGGCTGCTGGTCTGCGCGATTCCATGCTGCTCTATGATGTCCGCTGCATGGGAACA
TCTTTCTCGTCTTTCTCGTCTTCCTCGTCACAATCTCCCGTCGCCTCGTCCGTCGTCCTTCGCTTTGACGAGTATCGCAA
CGAGGCCCGTCTGATGGGCACCGGCTTCGACGTCGAGCCCCGGCTTAACCTCGTTGCCGTCGGCGATGACCGCAATGCCT
TCTCTCCACCCACTACTGCTGCCAGTGCTGCTAGCAGCGGCGGCGGTGTCTCGCTTTTCTCCATGGTCACCGGCGAGCGC
CTCGCCACCGGTACCGACATGATGCGGCGAATCAGCCAGCCGTGCAGACGCGACACCGCCGTGCCATCTCCCCTCATCCT
CCCCCGTGTTGCTGCGGTTCGCTTTGCCCGGCTGCCTGGCGACTGCACTTCCAGCCTGTTCGTCGCCGTCGGACACCAAG
TCCAGGTGTACTCTCTCGGTGAGCCGTTCGGACCCGAAGACGAAGACGAAGACGAAGACGGGCCAGACTCGCCTCGAGGA
CCACGTTTGCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62