GenePrediction:GLEAN_5318 Details

Name: GLEAN_5318
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:452642..451682 (- strand)
Length: 961
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:452642..452556 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:452482..452400 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_97:452284..452092 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_97:451950..451893 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_97:451818..451682 (- strand)
Length: 137
>GLEAN_5318 class=GenePrediction position=GCSC_97:452642..451682 (- strand)
ATGACAGCCACAACGGCCCCAGAAGGCGCTGCCTGGAGTGAGGCGGCCATTTCGATATCGTGGAACCAAGTCGTCAGCGA
CTACAAGGTGTGTGCAGAGGCCTCCCTTTCGGCCTCTTGGCGGCAGCTGCAACGAGTTCTTGGCTAATCGTCTGGCCCAG
GCTTTTCACGGCGTCCGCGCGCGTGGTGGCACGGTGGACGACCTGCCAGAGAACCTCAGAGAGCCTGTACTTCCTGATAG
CGGGTGAGCAGTGATCGGTCGGAGATGAGAAAAAGCGGCGCGAGGGCACGGGGCTTCACCTTCTATGTCACGGTGGCATT
GCTGACGCAAGCTCCTGGGCGAGACGGCCACATAGCAGACAAGAAACAAGGCCAGATGCCAAGCCTGAAACTGTCAACGG
ATCTGTTGGAGAGACGAAGCAGGCTGCTGCGGCCGAAACGACAACGGATGGCGAAAGAGCTACGAGCTTGGACAAAAATG
GGCCAGCTGCAGCACCAGCGGCAGAGTCGGATGCTGAGCTAGAGCAGACATTTGCATCCCCATCAGGCACGGTATGTCCT
CGCTAGATCAGCTTCTGAAGGAGCTCATGTCGGCGATCGTGGGGGGGGGGAGCAGCAGGCCGTGTTTCGATAGCGACGGG
CGACCAGGTTTCTTTTCAGATTGTTTTCTGACGAGTCTTTTTAACGTCACAGAATCAGCTCCCAGCTCCCAGCCTTATGC
CCCCGCAGGCAGTCTTGGGCAGTATGGATGGTAGGTTATCTTGACTGCCAATTCTCTTTCTCTCTCTCTCTCTCCCTGCC
TACATCCTGCTCACGGTCTGGTAGGAAACGAAAGCCTGAAGAAGCTGCTGATGTCGTGGTACTACGCCGGTTACTACACC
GGTCTGCACGAAGGCCAGCAGCAAGCAGCACAGGGCCAACCAGAGGGCGATCAGCATGCCGAAAACGAGGCTCAGCCATG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62