GenePrediction:GLEAN_5321 Details

Name: GLEAN_5321
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:443410..440383 (- strand)
Length: 3028
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:443410..443178 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_97:443091..442686 (- strand)
Length: 406
Type: CDS
Source: GLEAN
Position: GCSC_97:442615..441582 (- strand)
Length: 1034
Type: CDS
Source: GLEAN
Position: GCSC_97:441503..440860 (- strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_97:440669..440383 (- strand)
Length: 287
>GLEAN_5321 class=GenePrediction position=GCSC_97:443410..440383 (- strand)
ATGTCGTACGAAGACCACTCCGAGGACGTGGCGGCAGACTTCCGGGATGCCCTCGAAGGTCTGACCATGAACTCACGCGT
CGAGATCACGACGTTGACGGTCATCGCCCGCGAGAACACAGAATACGCCCATGCCATATCGGAGGTGCTGCAAGAGCACA
TCAAGAAGGCAAGTTACCGGCTTCCTCTCCCGGCCAGCACGGCTCGCGCCCGCCAGCTAACAGGTGTGGTCAGGTGGCTC
CTCCGCGGAAACTCCCTGCAATCTATCTGCTCGACTCAATCGTGAAAAATGTCGGGACGCCCTACACAATCTACTTCAGC
CGCGGCCTATACACCACCTTTATGGACGCGTATGCGTCCGTTGACAATGGCACCCGGCGCAAAATGGACGAGATGCTCAA
GACATGGAAGGAACCTGTGCCAGGCTCGGTTGATCCGCGACCAGTCTTCTCGCCCGAGACCGTTCGGCCGATAGAGAGCG
CGTTAATGAAGGCGAAAGCATCTGCCTTCCAGGCGCAACAAGAACACTTGCGAAGCGAGCAGCAGCTTCTGGGCCGAGGG
CGGCCACACAATTCCGGCATGCCCTACCGAGAAACACCTACACCTCCCGGTGGACGGCCAGGCTATCCTCCTCAAAACCC
ATATCCTCAGCAGACAATGCTGCCAGGTTCAGCTTCGTCCCAGATGCCGGTGCCACAGCAACACCAGGCATACCCTATAC
ACCCGGTAAGTAGTACCTCCCTGGTCAATCGGTGGCTGGAACGGTCCCGTTTTAACAGCTCTACGACCTCTGCAGGCACA
CGCTACGACACAGTCAACACCACAGCCGCCTTCGACTGCGCCGACAGCCGGGCCATTTCAGCCTCCCCCAACATCACAGA
TACCCTTTTCCGCCATCGGCTCGGCCTCCAGAATGAGCATAGAGTCGCTTAATGAGGATGTCGGGCGGTTAATCCTGGCC
ACCAAGGCAGAATTTGCAGAGAAACCGTATGATGCTAGTGTCGCAGCGAGGCTGAAGGCGCTGCTTGACCTGCAGATGAT
TCTTAAGAGCCAGAACCTCGAGTACGACAAGTTGTTGCTTGTAAAGAACCAAATTGATGCGCTCTCTGTAAACCTGCCGA
GCCATCTTAAGGCCCAGTATATCCCCACGGCTACACCACCGGCAGGATATCCCCCTTACCAACCACCAGCCAGCTCGTCA
GCCGCCTCCGCAGCTCCAACACTCAGCGGCCTGTCACAGATTCAGCTACCACCAGGGATAGCAGCAGCCGCGGCTGCGGC
GTTGGCCGCCGCCCACGCTCAGGGGGCGGCACCCGCAGCTACAGGCGCTCTCCCGCCGGCGTCTGGCACGGCCGGATCGG
TGTCTATCGACAGACTGCTCGGAAAGGGGGCGCTGGCAGCGATCTTGGCGGCGCGACAGCAGCAGACAGCAGCAGCAGCT
CCAGCACCGGCACCAGTTCCAGCTCCAGCTCCAACACCGGTACCAGCACTGCAAACGCAATCGCTTCCGCTAGCATTGTC
ACAGGCGCTTTCACAGATGCTTCCACAGCAGCATCAGCCCGCCGGTTTCTCCGGAGTTGCTCCTGGCGGCAATGCTGGCA
ACCCATTGGCCCTCATGGACATGCTACGGAAGGCGGGAATTCTGCAAGGCCAGCAAGGAGCGCAGCACGCACAAATGGGC
GGTTCCATGCCTGCGACGCTGTCGTCAAGCTTGGCAAGCATACTGGCATCAGCGCGAGCACCAGCCTTGGGAGCGCCAAC
CTTGGGGGCGCGGGTACCTTTGCAGGAGATCCGAAACGAGATTTCTTTCCAGTCTGCATCTTTAAAACAGTGAGTGCACA
ACAAGGACGTGAAATGCTGATGTCACGAGAGATAAAAAAGACGCTGACACGAGTTCGCGCCACAAAGCTTCCGCCCTCAT
CTGCTTCCGCTCCTGTACGAGAAGTTGGGTCCTCCCTGCACGCAGTGCGGACGGCGGTTTCAGACAGACGGGGCCGGGCG
AGCAGCCAAGACGGCACACATGGACTGGCACTTTCGTGTGCACCAGCGGATTGTCGAGTCGGAGAAGCGTGGCCAGCACC
GCAGTTGGTACGTCGACCAGGCCGATTGGATTCAATCCCGCGAGGCCCCTCCCGAGGCGGACGGAGTCGATCATGGTGCC
GACGGCATCAGAGGAAGTTCCGGGGCAGCGGGCGCCAACGGACGGAGTAGCAGCCACCAGGGAGCCGGGTCCTCGCTCTC
AGGGACAGGTGGTGCTGGCGCAGGCGGCGGAAAGGTGCAGTGGATTCCGGTGCCGAGCGATGGGGCCGGTGCCAACCAGG
CATGTCCGATCTGTCAGGAACGGTTCAAGATGCAGTGGCTGGACGAGGCGCAGGAGTGGGTGTGGATCGACGCCGTGCAG
ATCGGCTCGCGCGTGTACCATGCCAGCTGCCACGCCGAGGCCACCAAGAGCGGAGCGATCCGCGATCATCCGGCAGCGAG
CGCCATGGCAGCCATGCTCTCCGGCGTGCTACCGCCACAACAGCTGCCACAGCAGCCGATGATACCCACAGGTCCGTCAG
CAGGACGTCACGGGCGCGGCACGCCTCCAGACTCTGTTCTGGGCAAGCGGAAGGCGGAGGACAATAGTGGCAGTGGCAGT
GGCAACGGCAATGGCAATGGCAACAACAATGGCAACAACAATGGCAACAACAACGGCAACGGAGCCAATGGTGGCGGGCA
TCATGGTCACGGCCATCGCAGAGATCAAGGTGGCGCACAGCAGTCATCACCGCTACCGGGTGGCGGAGGAGGCAAAAGCG
GCCGCAGCGGACGAAAAAAGAAGCGCGGTGCTGGAGGCGGTGGTGGTGGTGGTGGTGGTGGCGGTGGTGGTGGCCCGAGA
AGGCCGCCAGATCTGGACCGAGTCGATCCGGATATTGGCGGCGGTGGCCGAAATGGGATGCGCAATGGCAGTGGCGGTGG
CTACTGGACGGATGGACCTGGTGGCAGCAGCTCCAATCCTGGTGGCGATGACGTCGTGGTGGACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62