GenePrediction:GLEAN_5323 Details

Name: GLEAN_5323
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:426867..425077 (- strand)
Length: 1791
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:426867..426860 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_97:426787..426014 (- strand)
Length: 774
Type: CDS
Source: GLEAN
Position: GCSC_97:425950..425077 (- strand)
Length: 874
>GLEAN_5323 class=GenePrediction position=GCSC_97:426867..425077 (- strand)
ATGAGCAGGTGAAGAGACCAACCTCCGAACCAAGAACCCACCAAGATCGCCACGTTGGCGCTCCTCATTCATTCCCACAG
AAATCCCGTCGTCGCCGCTGCCGCACACTTACAGGTGTCTGCACCTGCCAACTACAAGAATCAAATCCAGCAGCTGGACA
TCTTCCCACCGGCTTCACAGCGGACGAGGACCAGCAGCGGCGACGGCGGCGACCGGAACTCCTTTCTACCTGCTGAACAC
GGCCAAAGGCAGCAGCAGACGGCGCGACTCTTTACAGAGAGACGCGGGAGACAGACCGCCACGGTGGATATCGCATCTCT
CCTAAAGACAGCAGACTCAGATGAGTCCCCGGCCTCCCCCCCCTCGCCGAAGCCTCTCGCAACTCTACATCCGCCAGCAC
TGCAGTACATTGCCTACCAGCAGGAGCACCAGTCCCGATCGACCTCACTGCCTCCGTCCCAGCTGCTCCCGCCGGCCATC
GCCTCGGCTACACCGTCGCCCAACTCAGCCCCGGAGCCGCGGCTGCCTCCGATCGCGTACGCTGCAGCAGGCGGGCAGCC
AAGGGGAGGTCACGGCATCAGCATCGGCATCGACGCCTCCATCGCGGCAGGGGTACGGCGAAGCATGCCTCCCTACACGG
CTGACAGTCCGGCCAAGAAACAGAGCAAGTGGTCGGCAGAGGAAGACTCGCTGATCATCGAGCTGCGCGGCGGTGGGATG
AAGTGGGAAGACATCTCAAAACGGCTACCGGGCCGCAGTGCTATCAGCTGCCGGCTGCACTACCAGAACTACCTCGAACG
GCGGAGCGAGTGGGACGAGGAGCGCAAGAACAAGCTCGCCCGGCTGTACGAAAGGTGAGAGGAGCGGTGAAGGGACAGAA
GTGACAAAAGTGATAGAAGCTGACCTGGTGCGTGAAGATTCAAACCTGAGATGTGGGCTAGGGTTGCCGAGGAGATGCAG
GTGCCCTGGCGAGCAGCCGAGGCGATGCACTGGCAGCTGGGTGAGGCCGACATGGCGCGACGGGCCGGCGTGACGCCGTT
CTCGCTGTCGTCCATGGCGGTCGACTCGGCGTCCACACATCACCGGCAATCGCCGTCGAGGGCTCCATACTCACACGGCC
AAGGTGGCATCCGTGCCGAGACAGCAGGCAGCAGCGGAAGTTCCCGGTCTCCCCGTTATGGACGAGGTGGACCGCCTCCA
CCGCCAGCGATGCTGGAAGACAGGCCTTTCGAGGGCGGTGGCCGTCGAGAGCCAGGACCGCGGACTGTGTTCGGTGGTGG
CTACCCGGATGTGGCCGGCACGATGTCCCAATATCAGCAGCAGCAGCAGCAGCTCTACCATCCGACCGGACTGGGCCTGC
CACCCATTCAGACAGCAGGGCCTCCACCCTTCCAGCAACAGGAACGGGCAGTGGGGGGTGGAGCTCTGCCGAGCCTGGCG
GAAATTACGACAGGTGTCAGCCCATACAGCACACCGGCATATTCACTCGGAACCAGCCCGGCCCCAAGCCAGTCAGCAAG
CCCTGTGTCGGCACATATCGTGTCTGGCCCCATCCCTCGATCTGGATATGGATTTGGCGGGCCAGGGCCGGGACCAATAC
CAGGACTAATACTAGGACCAGGACCAGGATCAGGATTGGGACCCAGTACGGCCTACGGACTGCCTGGGCTGTCGTATCCA
CCGATGCAGATGGGGAGCGGACCAGAGCCGCGGGCACCAGCGGGAGGAGGAAACAAGCGGCGAGCAAGTCCAAACTTTGA
GCCACGAGAGCGACGGCGACGACAACTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62