GenePrediction:GLEAN_5325 Details

Name: GLEAN_5325
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:412595..410425 (- strand)
Length: 2171
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:412595..412487 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_97:412291..411615 (- strand)
Length: 677
Type: CDS
Source: GLEAN
Position: GCSC_97:411553..410842 (- strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_97:410774..410425 (- strand)
Length: 350
>GLEAN_5325 class=GenePrediction position=GCSC_97:412595..410425 (- strand)
ATGGACTTTGGCCATCTTGAGTTCGACACGCTAGGTGCTGGCGACTCGGCTTTGTCGACTCCCGAGTTCGATTTCTATGG
CACCTTTATGCCGACAGGGGACGTGACCGGTGGCGTTGGGGGCCTTCAGCCTCTGTCCGGCTACCAGTATCAACAGCCTC
AACATCAGCAGCATCACGAGCATCATGAGCATCAGCATCAGCATCAGCATCAGCATCAGCATCAACCACGACAACTTCAG
AACCACCAGCACCATCACGTCCGGGAGGAAGACAGCTTTGATGACATGACATATTTGACCTCAGAGGAGAGCGTGGCCTC
GGCGGTATCAGTCGACAGTGGCCTGCTGCCCACGACAACACCAACGACGACCGGTGCAATCCTGGTGGCCTACTCGCTGG
CCTCGACGGGCGCCATGGTGTCGCCTTTGGTGCATGCCTATGCCTACCCGTCTGGTTCGGCAGCGCTCAGGCCTTCGGTC
ATCCTGCCGTCGCACTCCTCCAAGGTCTCAAAGAAGACGGTAACGGCAACGGCGACGGCGACGACAACAACAATAACAAC
GAATAAGCTTCTTCCCGGTCGCCTGTCGTCTCCAGATGCCGATCGAGTTCGTCGCATCTCCGCTGCCGCTGTTGTCAGCC
GGCAGTCCGAAGAGCTGTATTCGGCAGCGTCACCAACGTCTCTCAGCAAGCGACTCGAGCGACGCGGCCACACCAAATCG
CGGCGCGGATGCTTCAATTGCAAGCGGCGCCGTATCAAGTGCCAGGAAACGCGGCCGTCCTGCGGACACTGCGTCAAGAC
GGGCCTGCAGTGCGAGTACCCAGCATCACCGCTAGTCAACCACCAACCGCAGCATCAGATCCCGCTCTTCAGCCTGCAGG
ACATGCGCTTCTTCCAGCACTTTCTGGTGCATTGCTGCCCTCATCAGCCGCTGGGCAACGAGACGCTCTGGACACACGAG
ATTCCGTGTCTGTCACACAATGTGAGTCATTCTGATGCTGTTGCTGCGATTTTGTTCTTTCTGCTCACGTTGCTTTCCAC
AGTATGACTACCTGATGCATGCACTCCTCGGCCTGGCTGCGTCCGACCTGATGCAGACTGACGCTAGCCTCGTGGCAGCG
GCTATGGACCACCGGCTCAAGGCAATCCGCGCCATCAAGCGAGCACTATCGCCGGTCTCCAAGCAGCGGATCCCGGCGAC
TCTCTGCTTGCCGCCAGGCGGAACAATTGCCGTGAAGGGTGCCCATGGCACCGACAAAGCCAATGGCAATCTAGAAACGA
CGTCCTCGTCAGTATCGTCGGTGTCCTCTACTTCACACTCTATTCGTTCCGGAGCAGCGTCACAGCCGCCACCGAGGACG
ACGTGGGACGAGAGTGCAAGCGGCTCGAGCAATCCGCTGTTTGAGGAGGGCAATGCGCTGATGGCAACGTGCTTCGCATT
AACGTTCCAGTCGGTCGAGCTCGACGACGGCATGGTGGAGTATATGACGTTCATCCGAGGCATCCTGCTGGTGGCGATCC
AGATGCACATACGCGGTGCCCGACTGCTGTTCCGCAACCTGCTGAACAACGAGCAGGCGGAAATGCTGAAGCCGGCACTG
GATCCCATGCCGCCGATCGAGCGGCAATGGGGGGAGGCGGCCGTGGCAGCCGTGGAGGAGCTGGAGCCATTGTGCCGAGG
GGATGACATGGCGATCAGCTATCATGCGCTAGTGCTGCAAATTGCGAGGGCGCTGTTGGTGTCTCCGGTTGAATGTGAGT
TTCCTCTGCGTGCCTCTGCATTTTGTTTTCTCGTCTGTCGCTCATCCTTCTGACTTATCAGCATATGCGGCCGTGACTCG
CCATTATGCCTGGTGGATGCAGCTCCCGTACGAGCAGTTTCGACAGATCATCAACCTGGACCGGCCGGTGTTTGTGTTGC
TGGCGACGCATTGGATCGCACTGAAGCAGATTATGGTGCGAATCACCGACGCAGAGAAGTCGTTTGACAGCCGGCTTGTA
GGGGAGCAGACGCAGAAGGAGAGCACGCAACACGGCATGGATATGGGCATCTTCCGATGGCTGAAGCACTTAAACCGGCT
GGTGAGACCAGACTTTGCGCTGTACAACGAGTGGCCGTTGTGGGTAGAAGTGCAGCTAGACCACAATCCCCGGGCATTTG
GCCGAAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62