GenePrediction:GLEAN_5326 Details

Name: GLEAN_5326
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:410047..408958 (- strand)
Length: 1090
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:410047..409132 (- strand)
Length: 916
Type: CDS
Source: GLEAN
Position: GCSC_97:408998..408958 (- strand)
Length: 41
>GLEAN_5326 class=GenePrediction position=GCSC_97:410047..408958 (- strand)
ATGACAAGTTCAGTGGTAACTGACAGCGCCAGCTGCCTTGTCGATCCCTTTGCCGACGACGTGGCGGCGCTCACGGACTC
GGCCGAGACCGGGGACGGCGACGACGGCCAGCAGGACAGTGCTGCGCCGACGCGTAGCTTACGACCGACATTGCAGCTGC
AGATCGAGACGGCCGGCAAGGCCCTGCTGTCGGCGCCAGGCCCGGGGCGGATGGATCCGATCCCGACGTATGTCGTGGAC
GAAGAGGGGTTGCCGCAGGACATCCAGCACCGGCCGGCCTTTGTGTCGATGCGGCAGTCGCAGTGGTCGGGCGACTGTAC
GCTTGTTGCGGGCGGCGCGCCGTGGCGGGCGGTGGCTGCCGGTCGGAGCTCCACCGATGTCCGCGTCGATGCCGACGTTG
TCGACATGGTGCTGCTGCAGACGCTCAGCCGGACAACGTACAAGTGCGGGCCGGGACGACCGCCGCAGGTGTGGCTGGGC
GGCGACGACGAGACGTTTGCGGTGCGGTCCCGGCGGGTGTTTGGGCGTGCGCACGGCTTTGACACCCGGCTGGGCTCGTT
TGAGTGGCGATACGGATCACGCGCAGAAAGGCTGGTGGCCAGCAGTAGAAGTGGCAAGGTCGAAAAGGTCGACAGTCTGC
TGGTGCTGGACCGTCTGTCGGACACAGCACCGTGCACGCGACGGCCGGTGGCACGACTGATTCGCAGCGCGACACTGCGC
AGCCGCGGCAGCTCGGCGTCATCGGCCGGCTCTGGCGGCCGGCTTCAGCTGGACCACGGCTGGTTAGCTGGCGAGGAGAT
CTCGACCACAACGATGACCGACCGCGACTCGTTTGTGGTGCTGGCAGTGACGACGTGTCTGGTGATGCTCAAGAAGGAGG
TGGACCGGCGGCGGGGACAGCAGATTGCCATTATGGGTGCAGTGATTGGGTCTGGGTAGGAGAAGGGAAGAGAGGGAAAA
GAGGGAAGAGAGGAAGAGAAGAAGAGGTGAGGGAATTATAAGTGTATAGATAGTATTGTACTACAGAACAAGTCGTACTT
TCCCTACAGTCGTTGGGTTCCTGCCTTTTGTGCGTGGCTTCCATTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62