GenePrediction:GLEAN_5327 Details

Name: GLEAN_5327
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:397703..393142 (- strand)
Length: 4562
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:397703..397513 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_97:397396..396173 (- strand)
Length: 1224
Type: CDS
Source: GLEAN
Position: GCSC_97:395975..395925 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_97:394815..394748 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_97:394583..393551 (- strand)
Length: 1033
Type: CDS
Source: GLEAN
Position: GCSC_97:393499..393142 (- strand)
Length: 358
>GLEAN_5327 class=GenePrediction position=GCSC_97:397703..393142 (- strand)
ATGACGCAAGACCTGGACCTAGACAAGGTCATTTCTGGCCAAGACCCCGTTACTAGGAGCCTTGTGCCGGCCCACATTGA
GCCTGGCGTATTGATTCCGCTTAAGACGACGCTCGAACTTCGCGACGACCACCAGTGTGGTCAGGCTTTGATCACCCGGT
CCCCAATCCGATCAACAAGTGCTGTCATTAGGTTTGTTTCTCCGTGGTCTCTGGGAGCTCATTTCCTCAGTAGCTGTTAA
ACGGACTAGAAGAGGACAGCAAACTCCTCGCTTATGTTCTTCGTTCTAACACTGGCCGTCTTCTTAGCCTCCTGCGCGAC
ATGCTTCCAGAGGAAATTGTTAAGGGCATGCCTCACCTGCGGCGCTGCGCAAAACCCGCCGACCTGCCGGCTCACTTGAA
GTCGCAGTTTATGAACGACAATGCCACGAGCAAACAAATCCATACAGGAAAGTCAAACTGGGTTTACGTTCTGCTTGGCC
TAGAGGCCACCATTTCACAGCAGGAGATGGCTGAAGCTCTGTCAAACGTCGATGGATTTGAGGATGGAGTGTTTATTGCT
TCAATCCCTGTGCCTCTTTTGGCACCGACATCCCAAATTCAGGCTGCTCTATGGACCACACAATTCTGGCCGACCATGTA
TCGGAAAAACAACCCGCTTGGTCCACACCCTAGCCTGGTGACCCGGGCCACCGATGAGATTGCCGAAGATGCGCCTCTGT
GGATGGCGCTTGCCCATGACATTGCCTTAAAGGCTAAGGAGTCTGGACAAGGAGAGGCGTTGGGCGCCTGTATCGTGTAC
AGAGGGAACGACGGGCCCCGACTCGTCGCAATCGTTGGCGACGCTCGTTGGCAGCAGCAACCGAAAGGTTCTCAGACAGG
CAACCCCATGGCACACGCCGTTCTCCGTGCTATCAGCATGGTTGCCCAAAAGCTTGTTCGTGCTGAGAAGAGAAACCAGC
GCAGAACGAGTGCAGCCACGAGCGATGACAGCGCAGTTGTTCCAACAGAACGGGCCAAGGAAAATGTAGCTCCAGTCAAC
GACCAGTACAAGAAGTTTCGTTCGCCAAGGGAGACTCCGGGAATGGTGCAGTGCGCCGTCCAAGATCGGGTGCGTGACCG
TCTGAGCCGCAACAGGGACCGTGGGCACGTCGGCCACCGACAACGGCTTGCATTCGAGCCCTTCCAGGATAAGCCGACCC
TGGAGGAAGAGGAGAAGATTTTCATGGAAGAGCATCCCACCCCGGACGGCTACCTCTGCCATGGTCTTGAGCTATACGTT
ACCCATGAACCGTGCGCCATGTGTTCTATGGCGATTCTTCACTCGCGCATGGGAAAGGTGGTCTTTGCCAACCGCATGCC
TCTTACTGGCGGTCTCAGTGCCGAGGATCGTGCTCCAGCACCAAGTACACGTTGTGGTGGCCCAACAGCTAGGCAGACCC
AGGAAGAGAAAATTGAGCGCAGTGGAGAGGGCATTTATGGGCTGGGCCTGTTCTGGCGCCGCGAATTGAACTGGAGTCTC
CTGGCTTGGGAGTGGGAGTCGCACTGCCATTGTCAGCCTCTGGCGATGGACCCTAGGACCCATGCATGATGACAGGAACA
ATTGGGATTGATCTCAGGTTGTACCCGGTTGCCCCATATCCTGCCAACAAATACTGTTGGGTCGTAAAGCGACCCAAGTA
AGACCGGTTTCTGCCTTTTCATTTGTACATTGTTTTCTTCATTCCCAGGGTTATGGCACGACTCAACATCATGGACGATA
TGAAGCCGTGGAGACATGAGTACGTCCTCTGGGTTGGCGTTTATCAGCAGCAAGGCATGGGCGGAGAGGGACGGGCTAAA
ATAGCGGAAAGAAAGGCACGAAGTCGGTCAAGACATGAGAAGCTCTTCACCGCGAAACGTAGTGAGGGAAGGACGATGCA
CTAGCGGCAAAGACACGACGCATCGCACAGACACCATGGCAGGAGCTACCCCGGACTACATTTGTACCTTAAAATATACC
CAAGCTGTCTAGATGATACCGAAGGCTGGCCAGCTGCAATCTGGCTGGCTGCATACAGCAGTTGCACAGCGGGAACAGGA
AGAGTAAGGGGCTTGAAGACAAAAATCAAAGGGCTGTAGCGAAAACCCATTCCTTGCATTTGCTTGTCTCCCTGTTGGCT
CGGCTGAAAGAGGGGGCCTGCTAGAGAACTCTGCCGAAAGACTCTTTACAGTTTAGCCACAAGATAATTTCAGCCGCCAA
AAATCCTATACATAAAAGATGACGGTGATAGAGAGACACAAAATAGCTCCCGAAAAAGTAAGGGACCACGGGAACAGGTC
TGATGAGCTTTTTGAGGTCTGCCCAAAGGTTTGCCCTCCACTCACTTTCCCCCCATCTCAGTCACCCTCGTCTGTCTTTC
CACACCCCCCCCCCCCCCCCCCCTCCCCCTCTAACATCCACTAAGAACTCTCCACCCTTCCACCCTTCCGTGAACCTCCC
ATTTTGGATTTGCTGCTTTTCGTACCAACCCCCCCCCTCCCTTCCTCTCTCTCCCCCTTGTTCTCCTCCACCGTCTTCTT
CTTTATCTTCTCATTCTTGCCGCGGTATATTATCTGACCATTGCCTTCCACACCCCCTTCGCTTCCCCTGCAAAAGTGAT
TTTCTTTCCTCCTCTTCTCTCCTTTTTGACAAAATAAGAGCGCACTTGCACCCCGTGCTCCTTCGCCTGTGGCAGCTTCA
GACTCACAAAAACCGGGCAGCCATTCGCCCGACTTTGAAATTCTCAGAATTTCAGTCACGGTAGTCTCAGCCCCTCGCAG
AAGTGCTGGTGGGTTGCTGTTCAGGAGCTCGCCTGTTGGCTTGAGCTGGTGCTATTTTGCTAGACCTGCACAAGCCTGCG
CCTTACAGCTTCAGCAGCTACTACATCACGGGCGCCATAAGGGTGCATCAGCCACTGAAGCTGCCCGGTACAAACGGTTG
CTGCCAGCTTGGAGGTTGGAACTCGCCGTCTACCAGTTGGTGAGCGTGACTTCCGGACCGGTTGGGACAAGGAGAGGAAA
AGCGACAAGGGGAGCACAATTAATACGAGACCCACAGCAGGTCCTTCTAGCTGGTTACCGAAGAATCTTCCCATCCACAG
ACAGCAGTACAACAGGGGACACGAAATTGAAGAAGCGCGTCATTGACGAAGCTGAAGACGACGACAACAACGTTGTCTGT
CGTCTTCTGCGTCTTCTCGTACGAGTAACGCGCCGTGGCGACAGCTTCTCGTGGCCGAACATACACCGATTAGCACTAGA
AAGCACGAACAGCATCGCCAGTATGCCTCCTGCCAAAATGAAGGCGGCCACGATCGCTGCAGCTGCAGCTCATTCTGCCA
CGGCCTCGACATCGTCCACTGGCACGGCAATCTCCACAACGTCAGGAAGAAAACGGAAGATGGACGAGAAAAACGTACAA
AAGTACTACGCCGTACGAGCTGGCGTGCGGCCGGGGATTTATTTGACGTGGCACGAGTGTCAAGCACAGATCGCTGGCTT
CAAGGGTGCACAATGTAAGAGTCATGTCCCCGATGCGGCCAGATCGGTGAACGCTTTTGTACTCTCCAAGACGCTTACGT
TTGCCCTCTTCCTACCGCCAGACAAGAGTTTCATCAGCCGCGAAGACGCGGCAGCATTTGTTGACGGGAAGAACCCAGAA
GGCGGTGCGAAGGACAAGGGCGAACCCCGATTCTATGCCGTGGTGGTTGGCAACCAGTCGGGCATCTATACAGACTGGGA
GGCGGCGTCACGGGCCATCAGGGGAGCCAAGGGCCCCAAGTACAAGAAGTTTCCCTCACGAGCAGAGGCAGCAAACTTCA
TCCGCATGTACGGCAGCGTGGCCACACGGCAGGCTCTAAGTGGTCCCGGCACGGCGAGCAACGGCACCGACGTAGCCAGC
GAGGAGGAAGAGGAGGAAGATAACGAGGAGGAGGAGGAGGAAGAGGAGGAAGAGGAGGACGATGCGGCACAGATTCTGCA
GCCGCCAGCGAAGCGGACGAAGGCGGGCAACGCAGCTGTGGCGGTGTCGTCGGCAGCAGTCCTGAATATATACACGGATG
GCAGCAGCCTGGGCAACGGGAAGCATGGGGCGTTGGCCGGAATTGGCGTGTTTTTTGGCCATGGCGACAAGAGGTGAGCA
GCTGCGCACGGGCAGACGGAAAGCTTGGCTAACTCTCGGCACAGGAACATCTCAGAGCGGCTGAAAGGCGAGCCACAGAC
GAATCAACGGGCAGAGCTGACGGCGATTATGCGAGCGCTACAGGCGGTGCCAGTGTCACAGCCGGTACGGATCTTCTCGG
ACAGCACATACGCCATCAACTGTGTGAGCGAATGGTACAAGAGCTGGGCGTCCAACGGATGGAAGACGCGGGGCGGTGAC
CCGGTCATGAACCAGGACCTCATCCGGGCAGTGCGGACATGTATCGACGCACGTGACAAGGCGAGCACGGCGACCATGTT
TCGGTGGGTGAAGGGACACAGCAGCGACTCGGGCAACGTGGCGGCGGACCTGCTGGCGAACCAGGGGGCGCGGCGAACAT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62