GenePrediction:GLEAN_5328 Details

Name: GLEAN_5328
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:392221..390416 (- strand)
Length: 1806
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:392221..392104 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_97:392043..390416 (- strand)
Length: 1628
>GLEAN_5328 class=GenePrediction position=GCSC_97:392221..390416 (- strand)
ATGCCGACGCTCGTGCTGACTAACTTTAACATTGTTGTCAGTGTTTTGGGAGGATGGGTGTCCCTGTTTGGGCTGGTGTC
GTACCTGTGCAAGGAGAACTTTTACCTGTCGGAGGCATGTGAGTGTTGTGTGTCGTGTCTCCCGAATCGGCGATGCGGTT
GCTGACGGTGTGGAACAGTGATCTCTCTGCTGGCGGGGGTGGCGTTCTCGCCGTCGGCAGCCAACTTTGTACGGCCGCTG
CAGTACGCCGGCTCGCAGGCCAACCTTGACGCGGTCACGCTGCACTTCTCGCGGCTGGTTTTGGGCGTGCAGCTGGTGCT
GGCGGGGGTGCAGCTGCCGAGCCGGTACCTGAAGAAGCAGTGGCGACCGCTGCTGCTGCTGCTGGGGCCGGTGATGACGG
GCATGTGGCTGGTGGCCGGGCTGCTGGTGTGGGCACTGGTGACGCCGCGGATGCCGTTTCTGCACGCGCTGGCCATTGGC
GCCTGTGTCGCGCCGACGGATCCGGTGCTGTCGAACGTGGTGGTCAAGGGCCGCTTTGCTGACCAGAACGTGCCGGTGGA
GCTGCAGCGCATCATCATTGCGGAGTCGGGGGCCAACGACGGCCTGGGCTACCCGTTTCTGTTTCTGGCGCTGTACCTGA
TTCAGTACACGGGGGCTTCTGGAGAGTCTGGGGGTGCGGCTAGAACCATGGGCCTCTGGTTCGGCGAGACCTGGGGCTAC
ACGATCCTGCTGAGCGTGGCGTACGGCAGCCTGGTCGGCTACGTGGCCAAGGAGCTGTTGCACTGGGCGGAGGAGCGGCA
CTACTGCGACCGCGAGAGCTTTCTCGTCTTTGCCATCTCGCTGGCACTCTTCACCACCGGAACCTGCGGCCTCCTCGGCA
GCGACGACGTGCTGGCCTGCTTCGTCGCCGGCAATGTCTTTACCTGGGACGACTGGTTCCGCCTCGAGACCCAGGACGAC
ACGCTGCAGCCGACGATCGACATGCTGCTTAATGTCGCCATCTTCATGTGGCTCGGCGCCGTCTGTCCCTGGTCGCTGTT
CGCTCACGGACCGGTGCCGTTGTACCGCCTCGTCCTGCTCGGCATCCTGGTGTTGCTGCTGCGCCGCCTGCCCTGGGTCC
TGGCTCTGCACCGCTACGTCCCGCAGATCGAGCACCTCCGACACGCCGTCTTTGTCGGCTTTTTCGGCCCCGTCGGCGTC
TCGGCCATTTTTTATCTGTACGTCACCCTTGAGTTTGTCGACGGCCTTTCGTCGACCGACCGACCGCGGCCCGACGTCGC
CCGGCTCGGCGACACTGCCACCGTCGTGGTCTGGTTTCTCAGCATCTGCAGCATCGTCGTGCACGGGCTCAGCATCCCCG
TCGGCAAGCTGGGCCTCTACCTGCCGCGCACCCTCAGCCGCAGCTTGCCGTCGTCGACCTCGGCCGGCCGCACTACCGGC
CTCTCCTCTGGCACCGACAACGGCCTCCCGCCCTTCCACATCGGTAGCCGCGTGAGCACGCTGGTGCTGCGCCGCAGCCA
CAACGCACGACGCAACCAGGACCAGCCATCCGCGCCGACACAGCCCGCCACGGCCGCCGACCGGACTGATGTGCAAATCG
TCCTCAGTGACCCGGACGGCGAGCACAACACCACCAACATCAACATCAACACTGCAGCGCGTCCTGTCTATCGCATTGGC
GGCTCCATTATTCCGAGCCGTGTCGCCACGGACGGTGGCGAGGCAGCCATCGCGTTTACCCCGAGCGGGCCGTCTACGCT
TTTCAACCGCACGATCCGCTTTCCTGACGAACCGCTGTCGTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62