GenePrediction:GLEAN_5329 Details

Name: GLEAN_5329
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:388304..382896 (- strand)
Length: 5409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:388304..387324 (- strand)
Length: 981
Type: CDS
Source: GLEAN
Position: GCSC_97:387227..383262 (- strand)
Length: 3966
Type: CDS
Source: GLEAN
Position: GCSC_97:383159..382896 (- strand)
Length: 264
>GLEAN_5329 class=GenePrediction position=GCSC_97:388304..382896 (- strand)
ATGTCTGCCCAAGACGGCTCGTTCGAAGCCCTCGCCGCCTCTCCTGGCGACTTCGCCGTCGACTCCGAATGGATGGGGGA
CTCGCCTCCAGCTCTCACTGTCGACTTCATGCAGAACCCGCATAGTCTGCTCCATCACGTCAACGACCTGGCTGGCCCTC
TGGCCAAGAAGCGAAACCGCCCGATAGCCAATGGTGCTGGTGGCACCCCAGGCGGCAAAGACCCCCTCATGCTCGGCCAC
AGGCCGGCAGCCGCAGCAGGCCTTTCCCAGCCGCCGACGGCCTCCTCGCCCGACTCCCTCCTCTCCTCCTTCCAGGACTC
GTCCTCTGACATCTCGTCTAAGCAGACTTCCATGTCTGCTCACTCTAGCCTTGTCAGCGGCACACCTGCAAAGAAGACCC
GGGGACGGCCAAGAGGCGCGGGGCGGGCGTACGGCACCGATGCGTCCGGGCGCTCAGCGGGCGGCCAGTCCAGGCGCGCT
ATGCAACCAGATGTGCATCTCCCGACCGCAGCGGACGACGTGGTGATGGCAGAAGGCACCTTTGACGCCGCCGCTCTGGA
GGTCGTGGACGCTGCGCCGCCAGACTGGAACATCCGCGACTACCTCCGTCTGGACGAGGACCAGGACGACAACGACGATG
ACGGCGACCTCGAGACCAGCTATCTGCACCAGCACAAGGCCATGGCAAACGGCCACCACACCGGCACCATTGACCCAAAG
TCCATCCAGAGAACGCCGAGTCTGTCGACTGCAGACGAGCTGTTTGGCGACGACACCATCCGACACGCTTCCACAACTGG
GGCCGATCTGAGTCCGTTCAGCGGCAACAGGGCGTCGCCTTTCGACTTTATGAGCCCTTCTAGCAGCCCGAATGCAGACG
ACCCCCAAGTCCTGTCATTCTCTACGCCGCAGATGTATGCCGGAGTCGGTGCCAGCAATGGGGACCAGAGTGTCCAGAGA
GGGCATAATAAAGCCCTATCGGTTTGTTTTTCCCTTCTTGATCTGCTTTCTGATTGGCCGTCTCCTTTGCGCGCGTCGCA
ATCCGGGAGAACCATGCTGACCGGACTGTTTTTGCAGCAATACTCGCTGAACCAGTCGATGAACAACCTCAAGACGACCG
GTTCCAGGGAGGTTTCGCCCATCTCCAACTTTGTTTTCAGTCAAGGCCCGTCGCCAACGACATACCTGAACAACGCACAC
TCGCCCGCAGAGAACACAGATATGCGGTTCGGCCAGTTTGCCGGTACCGGCATGCAGTCAATACCAATCGCATCCGGCTT
CATGTTTCCTGAAAGCGTTCCAACAAGCCCTGCCTCACCTTGGCAGGGAATTGCCATACAGCAGCAGCAACAGCAACAAC
AACAACAACAACGCAACGCTGCCAACGGCAGCGTATCTCAAACCTCCATGTTTCACCGAGGGCAGCCGGCAGCAGCAGCA
GCAGCTGGTCTCGCGAATCATCAGAGGCGGCCGTTGCGGTTCTTTGTCGGCGTGACTCCGCACAAGTCGCGTGTGGAAAC
GCAAATACCAATCATGATCTTCCTTTCGGCTCTTCCGCCAGGCGTCACAAAGCTTCACCTCCCTCCGCACACCATCTCGA
AGCCCAAGCTTCTGGCAAAGGATCCCATCGACCGGTCGCCCGACATGCTGGAGCTGCACACAATGGTGGTCTGCACCAGT
GCTATGCACAACGAGAACAACCGCCGGCGAGCATTGGAGCGTGCTGCCGCAGCCACGTACACGTCGCGGTCCTCGCCCAT
GAACGAGGGCGACAGCAACGACGACGACGACTGCCGACCAGCCAACGGCGGAGACATCTGGATATGCAAGGGCTGCATCC
AGCGAGAGCGGAAGCGGGCAAACAGGAAGAAGCTGAAGAAGCCGGAGGACGACGAAGAGTGGAGCCGAGATGAGCACCGG
CGGATCGTCATCTTCAACACGAACGAGACCAAGGACTGGCAGCGCCCGACAGCGGCCGCGCTGTCTTCCTTGGACGAGAA
CGCAGCAGGCAGTCCGATCGAGGCGGTCATCAGCGTCCCCATGAGAATCACCTGCTACTGTCGCCACCACGGCGAGAAGA
CCGGGTTCCAGGTCATCTTCACCCTGAAGGATTTCCAGGGCAACGTGATCGCTCAGACCATGTCGCGGTCGATCATGATC
ACAGACGACCACAAGACTCCCACGGGCCCCAATACCGGAGCTGTTTCGGCAACGGCACCGTCCTCAGTAGCAGACGGCGA
CATTTCTGCCGGCACGGGAGACGGCCAGGAGACAGCAGGGAAAACAGCGCCTGCCGCTTCCGCGTCGTCGACCAAGCCTT
CGTCCAGGATAAAAGCGCAGCCGTCAACCGCGGCGCAATCGGCGCCGGACCTGCCTTCAATGAAGCGCAATTCCGTCACT
TTTTCCGGGGCACAGTCGCCCGAGAAGGACATGGCACCAGAAGCTGCATCGGAAATTGCAATGGGCGCTAGAGCTCTTTC
ACGGGCAGCGTCTCCCAACGGTCTAAAGGGCCACTCCTCCAAGAAGAGGAAGGCAAATGGTGGACCGACCAAGATACCGA
CTGGCCTGGCAATGACGCGAATCGAGACATCCGTTTCGCCGCAGCAGTCGAACCTGCAGAGCTTCCAGAACGCCTCCAAC
TTCCGGGCCAGCGCTTCGTCTGCTTCGTCTGCCGTACCCTTCTCCACGGGTGCCTCGTCGTTTCTGTCTCCGACGTCCAA
CTTCGCGCCCGACTCCATGGCGGCCGCTGTTGATATGGCACTGATGACGGGCAACTCGGGCGATCCGGACATTGACAGCC
TTGTCGGGATGGTCCCGATGGCCACCGATTCGCTCGTCGGTGGCCCACTTACGCCCAACAGCCATACGGACCAGCAGGGC
GCGATGGCGAACGGTGCACGGTCAGCGAGCTTTGACAGTCTTGCCATGGCACAGAACGTCTTGTTCTCGGCGCCAGCATC
GACGCAGCCGAGCCGGCCGCCCAGCCCGAACGGGCTCTCGGGTGGCCCGATGCACATGTTCCGCCAACACATATATCAGC
AGCGACTACAACAGCAGCTGGACCAGGCGCAGTTTACACAGCAGTTCCAGAACGGGCTCTTCAACCTCCCCATGGCCATG
TCCCAACCGGCTGCGAGCCCGGCCTCGCACAACTCGGTGATCCACAAGATCATTCCTGCTGAGGGGCCCAAATCCGGCGG
CATCGAGGTGACGATTCTGGGAAGTGCATTCTACCAGGGACTGGATGTCATGTTTGGCAACCAGCGGGCGACGACGACGA
CATTCTGGGGAGAGAGCTCGCTGGTGTGTCTCGTGCCGCCTTCTTCGATTGCCGGCCACGTGCAGGTGACTCTGCGCCAG
CCGAACCAGCAGCGACCGTCACAGCCGTTCTCGGCCAATCAGCAGCGCGTCACCTTCAAGTACCTGGACGATGACGAGCA
GCAACTGTTGCGCGCAGCCCTGACGGTCCTATCTAGGAAGATGACGGGCAAGATTGAGGATGCGCAGGACGTTGCACGAC
GCATCATTGGCAGCGAGACGACCACCTGGGGAACCTCATCCGGCGGCGGATCTTCAGCTGGCGGTGGTGGCGGTGGAAAT
CCAACTGGCTATGCTGCCGGTCTGATGGCCAGCGGCAGCAGCCCCAACCTGGAGGCACAGCTGCTGAAAGTGCTAGAGCT
CATCGACCTGGACGACTCCTCGAACCAGACACGGCTCAACATGCAGCGGCGGACGACAGGACACAGCATGCTGCACCTGG
CCTGTGTTCTGGGACTGCACCGGTTTGTGGCCGGCCTGCTGGCCCGCGGTGCCAATCCGGATGTGCGCGACAATGGCGGC
TATACGCCTCTACACCTGGCAGCCCTGAACGACCAGGCAGGGATTGTGCGGCGGCTGATTCACGCCGGGGCCGACCCGAC
GATACGGACGCTGTCCGGCCTGACGGCAGCCGAAGTGGCTGCGTCGCGGGAGGTTGTCCGGGCCATCAAGCTGTTTGAGC
GCCATACGCGGTCGCGGAGTGGCGGATCTCTGCATAGCCGGACTAGCAGCGCGGCATCGCTCCGGTCGCTCTGGGAGCCC
ATGACGATGTCGGTCCTTGACCGGGCGTGGAATGCGACGGAGAAGTCGACGGGCGACGCGGCCGACAACAGCAGCCAAGC
CGAGGTGGACTCCTCGTCCTATGCAGCTTCGGGCGACGACGAGGAGAGCAGCGAGCAGGAGGAGGGTGACGAGGAGTGGC
TCGACATGAAGAGAGACTCACCGCGCCGTGGCCCGAGCATTCACAGCCGCCGGGGCACGCGGGACGTCAGTCCCACTGCG
CTCACACCATCTTCGGTGGCGACGGCAGCCGGTGCCTCTGATGTTCCTGCGGCATTGGCATCTCCGGCTGCAGCGGCCGT
GATTGCGTTCAAGGAACAGCTCACCGCTCAGTTCCAGCAGCTCGTGGCGCAGATTCCGCAGATCCCCAACAACCCACTGC
CGGACTACTACCAGGCCTATTTGAATTCTACGGCCTTCCAGCGGATCTCCTCGCTGGTGCCCAATATGAGCGGCAGCACG
GGGTCCCGGCCAAACTCATCTGATGCCCGCGGTCACGGAAATGGTCACAGGAACAGACACGGAAATGGCCACGGCAACGG
CCATGGCAACATCACGCCGGGACATAAAGAACTGGAGGGTCGCTGGTGGGATCTGTCAGCGTTGAGGGCAGGCCTCGCAC
CACCGCCATCGTACGAAGAGATCTTCCCTCGCAAGGGTGAGACGGACACGAAGCAGGCAACGGCGGCAGCAGCAGCAGCA
GAGGCGGAAGCCGACAGCAAGTGCGAAGTCCTGTACGACCAGCAGCAGACGGAGGCGGAGGAAGCGGCCGGGGAGGAGGC
CGTGACCGAGTTCGAGCCAGCCGAGTTCGGCGCAACGCTGCCGGCGCTGCTGCAGATTGGTCGCAAGCACCAGATCACAA
AGGAGCAGCAAGAAAACTTCCGGCGAGTGCACAAGGAAAAGCGAAAGGGACTGCGGTCCGACACATTGCTCTACACCGTC
TGGGTATGTTTACGGAGGGAGGATTATCCCTTTTTTTCTTTTTTTTCTTCTTCTTTCTTTCTTCTTCTTTCTTTTCCCCT
CTCTTTCAGTCTGCTAACATTTCAGATCCCTATGCTCATCGGAGTCCTTCTGCTCTGGTTCTCTGGCGCGCGGGCGTGGG
ACTTCTTCCCATCCGTGACGTTCAACGTGCCCTATGCAACAAGCCTGGGTCCGGTTCTTCAGCCTACAGGCGGGAACGCT
GCCCGTGCCAACACATTTAATGGTGGACGCCAGGACAAGGCAGTCCTAGACTCACCGCCCACAGCACAAGTGGCAGACCA
GGTCGGTGGCGAGAATGTTCTGGAGGCTGTGAGGGCGATTGTGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62