GenePrediction:GLEAN_532 Details

Name: GLEAN_532
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:437856..439511 (+ strand)
Length: 1656
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:437856..438086 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_97:438148..439112 (+ strand)
Length: 965
Type: CDS
Source: GLEAN
Position: GCSC_97:439184..439511 (+ strand)
Length: 328
>GLEAN_532 class=GenePrediction position=GCSC_97:437856..439511 (+ strand)
ATGATATCATCGGCGTGGCTCGGAGCTGCCACCATTGCAGCCATGGCTGCGGTGTCGTCCGCCGCCGACCACGCGCACAT
ACACTCCATGCCCGGTTTGACACAAGGGCAAATGAACTCGGAAATGGCACTGGCAATCTCTGCGCCCAGCGCCGGCACTC
CACAAATGTCGTACACGATCGTGCCAATGACCCCCGCTGTCGGTCTGGGCCAGGACGGGCTCACGCGGAATGTGAGCATG
TCGGCGAGGAGGAGAGATAGTCCAGGTGCTCTGCTAACATGTGATGGCGCAGTCGATTAGCATCGTCGGAAACCTGGTCT
TGGCTACTCACTTGAACTACAACAACATCACCGGCTCGAAAATTGCATACCTCTGCTGCGACAACCAGGACAACTCCTTT
ACCGACCCGGACGACATGCTCTACACTCTCATGGCCAACGCGCCCCGTGCCATTCTTCTCTACAGCCAGGAAGGCACCTG
CTGCGGCCTAAATGCGTCGTCGGGGCTGACCTACCAGAGCATTTTTACCATGGCGTCGATTTCTGATGCTGCGGTTGCAC
TGAATTTCACCAATTCCGATGACGGCGTCATCCGCGCGGCCATCTCTGGCAACGTGACCACTGCCGACCAAAGCCAGACA
ACCTCGAGCGGCACCAGCACCTCCTCCATTGCCATGAGCATACTCTACAGCATTACCGGCCTCATCACAGCCCTCTTCCT
CATCATCATAGCCACCGGCGCTATACGGGCCCATCGGTACCCGGATCGCTACGGTCCTCGCAGCGGACGCGAAGGTCTAT
CGCGCCAGAGTCGGGCCCGAGGCCTCGCGCGTGCTGTGCTGGAGACTCTTCCAATTGTCAAGTTTGGTGACCCCACCCCG
ACCAAGCCGGATCTCGGCACCGAGCTGGAGAGTCAGTTATCTTCTGAGCCCAGCCTCGCCACGACCGATGTCCAGGTGCA
TCATTTATCCGCAATACCAGAGGACTCCGTGTCACAACCCAAGAGCGTTGCGCACACTACGGCAACCACCAATGCTGTGC
CGGAGCCCCCAAATACTACAAACATCGGCCCTGCGGACACGGCAATTGGACCAAGCTCAGACGGCCTGTCCCAGAGCGAC
GACCATCTCGGCTGCTCGATCTGTACGGAAGACTTTACTGTGGGCGAGGACGTCCGAGTGTTGCCGTGCAACCACAAGTT
CCACCCGACCTGTGTTGACCCGTGGCTAGTCAATGTGTCTGGCACATGTCCTTTATGGTATGTCCTTCCCGTGTGGATTC
GTGTATCGCTGTGTGTTGCATACAACTAATGTGTCCCACCTGCTGCAGCCGCTTGGATCTCCGTCCCAAAGACGGCGAGG
AGGATGACACGTCTTCCACAGGAGAAATGCACCTGCCGCCGCCACTGGGCGATGACGAGGCTGCAGCTGCAGTTGCCGGG
ACTTCGACCTCGGGCCAACACAGACACCGTGCCTCCCGTCTGTTTGATCTGAACCGCTTGCGCCACGCCTCGGCCGAGGA
GCGCATCGAGGCGCTGCGTCGATACCGGTCGGAAACCCAGACAGACGGTGACGACGAGCACGGCCGATCCGTCAGGCTGA
CCAGGCGGCTGCGTGACAAATTCCATATCCGGACACATGCGCAATCCTCGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62