GenePrediction:GLEAN_5331 Details

Name: GLEAN_5331
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:379906..377769 (- strand)
Length: 2138
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:379906..379819 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_97:379697..379516 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_97:379433..377769 (- strand)
Length: 1665
>GLEAN_5331 class=GenePrediction position=GCSC_97:379906..377769 (- strand)
ATGGCATCCGTGGCACCACCGGCACAGCAGCCGTCGGCACCGGCAGCAGCACCACCCGACGGCGGAGCTGCAACAGGCGG
ATCAGCAAGTGAGTATCTTGGGTGTCGGATCGTATCCGTTTTTTTTCGTTTTGCCCCCTAGTGTGCCCCATACATAATAC
CGCTCGCTGTAGCTGGCCAGACCGCACCGCTGACGGGGCCCCTTGTTAGGTGCCAAGAAAAAGAACAAGAAGAAGAAGTC
GGCGGCGGCCAGGGCTAACGCTGCTGCTGCGGCGGCCGTATCGGCAATCCCAGAGCCAAGCGCTGCTGCCACAGCTCCAC
CCGCCAGCATCGACACAGCGGCAGACGCCCCCGACGACGACGATGCGGACGTGCCGGACAACGCGCCTGAGGTGAGAATT
GGCCCCCCCTGTCGCGGGTGAGAGGACGAGACGGCCGGGTGCTGACGCCCTACTCCTACTTTTCTCCTGGCAGATAGAAT
CGAGTGCTCGCAAGGACGGCCACGTAGATGCGAACACGTCTGCCGCCAGCCCGAAGAAGCCCGAGACAAACGGGAACGGC
CATGCGCGGCAAGCTTCGACAGCAAACGGAGACACAGCCGAGCGGGTAGACGGAGCTGAAGACGAAAAGGACGACGCCAT
AGCCAACGGAGACGCCACAAACGGCACAAACGGCAGGCAGAGAGTACGGACAGCGTCATTACGACAGACGAGCGATCAAG
ACGCCATGGCAAAAGAGGCAGGCGGCGATTTGGCGCTGCACGACGAAACAGAAGGGCTACGAGAGCAGGTAGAGGCGCTG
TACAAAGCACAGGAGGCGCAGAAAGAAGAGATGGAGCAGTTGCGGGCGGAGCTGGAAGAGAGCGAGGCCGGACGCGAGCA
GGCGGAGACGCAATACCAGAATCTGCTGGGGCGGGTGGAGAAGATCAAGGAGACGCTGGGCGAGCGGCTGAAGCGGGACA
GACAGGAGCTGGAAGAGGCCAAGGACCGAGTCGAGGAGCTCGAGGGGCAGAACGAGGGACTGCGGCAGGGCGGCGAAGCG
GCCGAGGCGGCAGCAGAAGCAGCCGAGAGAGAGGTGGAGCGGCTGCGCGGCGAGCTGGAGGCGGCAGGGCGGGAGCAGAG
CTCGGTGCGAGGACGGGCGCAACTGGCGCAGCAGAACTGGCAGCGTGAGAGGGAGGAGCTGGCGCGACAGGTGCAGCAGC
TGCGGGCGGAGCTGGAGTCGACGAGCGGAGCGATGGGCGAATGGGAGGTGATCGCGATGGAGGAGCGGTCGTTACGGGAA
GGTCTGTCGGAGAAGACAGCAGATCTGGAAGAGCAGCTGGCGACAGCACGAGAACAGAGCGAGCGGGCGCTAGAGGAGCG
CGACGGAGAGGCGCGAGCAGTCGACAGTCTGCAGCGGGCGCTGCAGGAGATTCAGGAGGCGCGGAAGCGAGAGCTGCGCG
AGATGGTGGAGTCGTCAGAGGCACAGTTGGAGGCGGCCAAGGCGCGAGTACAGGCGGCAGAGGCGGCAGCCGAGAAGGCA
GAGGCAGAAGCGGCGAGGCTGCGCAGCGAGAACGAGCGGACGGCACCATTTGAGCGCGAGGTCAAGGAGAAGAACCTGCT
GATCGGCAAGCTACGGCACGAGACGATTGTGCTGAACGACCACCTGACCAAGGCGTTGCGGTACATTAAGAAGAACAAGC
CGGAGGAGAACGTGGACAGGTGCGTTTTTGTTGTTTTGTTTCCTCTCCTCTTTTTTTCTTTTCTTTTTTTCGTTTCCTTT
CTCTCCTCTAACAACCACAGACAAGTGGTGACCAACCACCTGCTGCAGTTCCTGGCGCTCGACCGGTCGGACCCGAAAAA
GTTCCAGATCCTGCAGGTGATAGCCGGCGTGCTCAACTGGACGGAGGAGCAGAAGGAAAAGGCCGGACTCGCTCGGCCGG
GCACGTCCAACCTCAGCCTGCGGCTGCCGACGTCACCGTTTCACCGAACACCCAGCACGCCGTCGCTCAACACGGAGTTC
TTTGCCGAACAGGGATCAGGCAGCCGCGAGTCGCTCGCCGACCTGTGGGCTGGGTTCCTGGAGCGGAGCGTCGAAGAGGC
CGAGTCGGAGACGTCAGGGCCGCCATCGCGGAAAGGGAGCTTGCCTAGGGGTGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62