GenePrediction:GLEAN_5332 Details

Name: GLEAN_5332
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:370730..368860 (- strand)
Length: 1871
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:370730..370514 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_97:370444..369856 (- strand)
Length: 589
Type: CDS
Source: GLEAN
Position: GCSC_97:369691..368930 (- strand)
Length: 762
Type: CDS
Source: GLEAN
Position: GCSC_97:368878..368860 (- strand)
Length: 19
>GLEAN_5332 class=GenePrediction position=GCSC_97:370730..368860 (- strand)
ATGCGTCTCCTAAACAAGCTTCTGATGGTTACCGCTGCCGCTGGCTGTCTCCTAGCCACGGCCACAGCCGTACCTAGCCT
CGGATTTGCCCCCGTAAACGAACAGGCACTGAGTGGCCATCGGGCATTGCGAGGGGATTTGCTGACTAAGAGGACGCAAA
CATACAGGAACTCGACGGTGATCAACAAGAACTACATCGACAAGAGTTGTTTAGAGGGTAGGTTCTCCTTCACAAATGTA
GGGAAGAGCAGTTTGTTTACAGCATCACACAGTAAGTTCCCTTTAGCCATCCCAAAAGCCACAACCAATGAATTGAGCGC
CGATGTCAGGGCCACTGTCGTGTGTAAAACCTGCTACGTCAAGTTCACCGCAACGGCGGAGCTGGTCATACCGGATGCGT
CCGACGCCAGCTCGGTCATTATTTCGCAGGCACAATCGTATGCCAACGGGGTTGAAAACATGACAGCACAGGTCGTTGAA
GACATTGAAAACTCTGTTTCGAATCTCACAATGGCCACGTTCAAGACCGACATCAAAAACTTTCCGATGCCTACAGTCGA
CCTCGACTTTGATTTCAAAATTAGCAGCATTCCAGAGTGCCAGGTCACCTACACGTTTGACCAGCTCGAGGTGTTTGTGC
AGTTGCAGACGAATATTACCGGCAAGGCCAGCTATGAGCAAACCCTGTACAAATCCGAAGTACCGTTGGACATAAATGTT
GGTGACAACCTTGAGCTCAAGGTCACGGTGTTCGTGAGCCTTTTCATAGACGTCGACGGGGCTGTGAATCGTGAGACCGG
CTTCCACGTCAAGCTGGCCGACGGCTTGGCTATGACCGTCGACTTCTTTGGAAAAAGCGTGTCCAACATTGATTTGTAAG
GCTTTGTCTTCCCCCCTACCTTCGACTCTCTTGCTAACATTGTAGTAACAATGGCGCTTATGAGCTCTTTTCACTTGCTG
TACAGGATGATTCTGGTGCTACAATAAACGCCCGCTTACGTGTGACAGCAATGGCAAGTGTATACACCTCGCAAGATAGC
GACGTCACTATCTTTGGTATCGACATCCCTTTCTACGCCGGTGTCGGCTTCTCCCTTTTTGCCGACATCGCCGACTTTAC
TGTCAGGGTTAGAAATAATGTCGACAACTGCGCTGTGCTTGCTGAAGAGATCTTCCAGTATGCTATTGGCGCCAACGCTG
GCGTCGAGTTGGAAATCGGCGGTCACACCTGGAATCCACCTCCTCTTAAAGCGTTGCTGCCTGTGTGGGAAACCATTGCC
AGCCAGTGCGCCCCTACCACGTTGTCGAGCATAACGGCCACGGCTGCCATTGCTGCCGTGGCCAATGGGGCCAGCGACTC
CGTCACCTCCACCATCAGAACCACCTTTACGTACTTGGCTGTCGGCTGCCGCTCGGCTGGCCTTGTGAACTGCCCGGTGT
CGCTGCAGTCGACCACCGTGGTCACAGCCGAAAGCACCAGCGTCACAGTGGTGCCCCTGGGTTCGGACGCTACATGGCCA
GAGTCAACAGCCACCGCTGTCACGCCCATTGCGTTCGGAACCAACGCCAAGCCCATCAGCCTGTTCGTTTCTGGCACGCC
GACGTCCTTTGTGTCGACTGCCACGGCCTCCAGCAGCAGTGTCAGCAGCGGCAACAGAGGTAACAGCGGCAACAGCAGCA
GCAAGGCCGATGGCACCTCATCCGACCACCATGGCCTGTCTCCAGAAAACAAGAGAGTCGTCATCGGGGTGACTGTCGGC
GTGGGTGTGCCCTTGCTGGCGGGCATCTCAGTGTGGATTATGTAAGCGATCAGTCCTGCTTGTGAACCGAAGCCATTGCT
AACACCACATAGCTTCTACATCAGAAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62