GenePrediction:GLEAN_5333 Details

Name: GLEAN_5333
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:368464..365343 (- strand)
Length: 3122
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:368464..367395 (- strand)
Length: 1070
Type: CDS
Source: GLEAN
Position: GCSC_97:366097..365951 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_97:365553..365343 (- strand)
Length: 211
>GLEAN_5333 class=GenePrediction position=GCSC_97:368464..365343 (- strand)
ATGTCCCGGGCCCTCGACAAGGAGACGGTGGCCGCTCTGCAATTGGGCGACCCCACAGCAGCCTACCGAGCCATTGCGGG
CGTCCTGACACAGCCGTCGTCGTCGCCGTCCGACGAACTCCTCGACATTGAGTTCCTCGGCCGTGGTCATACTCTTTCGG
ATGTCCCGTCTGACGGCGACAGCAACAGCAACTTTTTCCTCCGTGACGGCAATTCCGTGGCCATCCTCAAGCTGGCCCTG
GTGCAGGCCTTTTTCGTCGCGCGACGGATCCTGCAGCAATACCAAGGGACGACAGCAGCCAACGCTGACAATGCCTCGAC
CTCACCCTCGTCCTTAGACGACATCATGGCGGCCACGGCCGTCATCCTCCTCTTCGACCCCGAGCATCTGACGGCCGCCA
ACACGCGCAAACGCATCATCCTATCGTCGCACGCCGCCACCACCCGCGGCTTTCTCCTGGCAGCCGAGTGCCGTCTGGTC
GACAGCCTGCTCACGAGCCACCTGCACCGACATACCAAGTCGCCGACGCTTTGGAGTCACCGGCGTTGGCTCGTGGCGCT
GCACGACCACCAAGCACAAGCGTGCCACCGTGACGTTGTCGACGTCATCATGGTCGCTGCCGTCCGCCACCCGCGCAACT
ACTATGCCTGGGACCACGCCCGGTGGCTGGTGACGACGCTCCGAGGCGACGACGTCGATGCGGCTGTCGCTGCTCTCCTG
CCGCCCGTCCACGACTGGTGCTTCCGCCACCATGACGACACCTCCGGCTGGTCCTTTCTGCTGTTCCTGCTGTCCAAGAC
CGTCGTGGTGACGGTTCTCGACGAGACGCTGTCCCAGGTGCTGCACATGACCGCGTCGCTGCACTGGACGGGCGAGTCCG
TCTGGGTCTTTCTACGCACGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCAACAGACAAGAGAAGACAGGGATCTCGGAC
CCGACCGACAGCTGCGACCGCCTCCGACAGACGGCTCACGCCCTGCAGACCAGCACCGGCCTCGATCCGCGGTCCCAGGA
CTGGAGGGTGCTGCAGCAGGCCCAGGACTGGTGTGTGAGGCAATCGTCTGTCATGTTTGGTTAAAGAGCCTGAGAGTGTG
TGTATTGCAAGGCGAAGGAACGGGACAACCGTCTTCGTTGTTGGCTGGTACATATGCGCATCTACACGCCCACCACCATA
CATGCACTTACATGCCCATCTACATCTTCGCCCCTTCCTGCATGGCCATTCATATTCCCTCGCAGCGGACGTACTCGAGT
CACACACGGCTACATCAAAGAACAGCTTGCGACTGTCGATGCGCTGCAGGTCGCAGAGCAGCGACGTGGGATTAGGAGCA
TGCAGAGAGGTGTGTCGCTGTTCGTTCCATGCTCGCTCGATGTCTAAGCAGTCCATGTCACAGCCTGCACTGCCTTGGAG
TCGACGTAGAAGCTGACCATGAAGGCACGGCATCGCCAGTGTTGAGTGTGGCCCGGAACAATTGGTCCTGCGACATGTTC
CCGCATCAACAAGACGACACGTCGGCATGAAGAACAAGACGACACCGGGCCCTCGAGATGCCCTTGAAGTGGTCCGTGGC
CTCCTGAGGGCCCGCCTTGACTCGTTTGTGGGCTCATCCTGCAGTGCGACAAGTCCGCAATCTCGAGCTCTTTGCATCAA
TCTCCTGCCCCTATTACATACGATGTCATTACTCGAAATTAGAACGGATCTGGTCATGTGACTTTCGCAATCCTGCTTCC
GTAGTTTCTCGGCACGTAGCACCGCTTGTTTGTAATCGAGTCATACTCGTAGACATGCCGGCTGCCGAGACGGCGGTTCA
GCTGCGACATAATGCTGCCTTTGGCTCGCTGAGCCACCGCGTCTCGAGATGCTTCCTGCCCTCTTCACCGTCGACGTCCA
TTGACCAATGGGGAGCTCCACTGGCAACCAGCTTTTTCGACCTCGGCAAAAACACAAAAAATATTCAGTGACACAAGCTC
GTTCAGGGGGCGGCGGAGCGGGACGTCTGGAAGCCCTTTGTCATGTGTTTTGGTCTGATCTGCGTTCTATTCCTAGATGT
GGCCGCCGTCCGCAAATTTCCTAACATGTGGCATGTTGTGGTGCCAATAGGCGGGAGACCCCGGAATGACGGGGGGCTTC
TGTACTGACGCTGACCGCGGGGAAAAGCTGACTGAGCCTGGCCTGCTATAGGCTATCAGGACCTATTCCACAGGTTGTCA
CAGGCTGGCCCACAGGCCTGTCGTTCGGTCACACCACCTGTCTGCCCAATATGACGTCGGCAGACACCAGCGAAGAGCCC
CTTGACCGAACGGGCTAGCGCCCCCTGTCAGCCCTGGTCCCCCACAGGTCGCTTGACCAGGCGGCCACAGGGCCACAGGG
CCCAGGACTGCCCGACCACGCCACAGCGCCGCCAGAGCACCAGACTCTGGCAAGATTTGGCGACAAAATGGGGCAACCCA
GCAGAGCCTGGCTGAGCCATCGCGATGGAAAATCGTCAGTGACACGCGATGTCCAACGGCGATCGGAATAATTCGAAAAT
TCTACGGCGGCCGTAAGGAAGCTCTGGGCGACGGCCAGAGACGGCCAGCCGTGAATGCATTGTATAAAGGCCCCTGCCAG
GCCTCTTCATTCTGGCATGAGGCTCTCCTGTTCATCAGCACCAATCGAGCAACTTGTCAAGAGATCCTCTACCATATCAG
AACACCGTCAACCCACCCACTGCATTTCTATTATAAACACCTTTCATCCCCTACCAAAAACACAACCTATCCTGTACAAA
CATCACCATGTCTGCCATCTCAGCAAAGTATGTAACTCACAAGTCCTCCACATCCACACAGCGGCCGTGAACCAATCAGA
GAACTCGCCACTAACACCGTTTGTTTCTCAGGGTCGTCCCAACACTCGTCACAGTCGGCGCAGTCACTGGAGTGGCTACT
TACGTGCGCAGGCAGCTCATGCGGGAGTCCCAGGCCTTCGACCGGTACTTCTCCACCTACAACACCCCGGAGAGCGAAGC
ATCGCGGAAGCGTGTGTTCGAGGGCGCTTCTGAAGACCCGCGCACAAGTCTGATGAACATCCTGGGCTGGAAGAAGGAGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62