GenePrediction:GLEAN_5334 Details

Name: GLEAN_5334
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:356479..352343 (- strand)
Length: 4137
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:356479..355165 (- strand)
Length: 1315
Type: CDS
Source: GLEAN
Position: GCSC_97:355085..354884 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_97:354360..354139 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_97:354047..353068 (- strand)
Length: 980
Type: CDS
Source: GLEAN
Position: GCSC_97:353013..352343 (- strand)
Length: 671
>GLEAN_5334 class=GenePrediction position=GCSC_97:356479..352343 (- strand)
ATGTTGGGCACTGTAGTACTCCTGCAGTTGATCCTCTGGACGACAGCTACTCACGCATTTTACCCGTGGTTTCCGGCTTG
GGTCTGTGAAAAAGACGACAGTATCTGCAACTCTAGCGATTCTCCCGAGGATGTCGCAAAGACAACGCGGGATGTCTCTC
CTCTGGCCGAGGGGTTGACCCTAAAACTGAGCCGAAGGAGACACGGTATAGACATGCCGCTTGGGGCCAGAGTAGCACGC
CAAGCCGAGAGATTCGCGAGGAGACATGCGGCTGCGGCCACGACGCCGCCTGCCACCGCAACGGCCGAGCTGGCCAAGCG
CGCCAACACATTCGCAGTCGTCACAGCGGCCACGCCCGCAGCCAGCAACGCAGTGGGCATCGACCAGGACGGCACGGACT
TCTCGTACTTTGTGCAGGCCACGCTCGGCTCCAACAAGACACCCATGTACATGCTGCTGGACTCGGGGGCCGGGACGACA
TGGGTGATGGGCACGGACTGCACGTCGAGCGCCTGCGCGCTGCACAACTCGTTTGGAGCGGCCAACTCGAGCTCGCTAAA
GAAGACGGGCAACAGCTTTTCGATCGCGTACGGCTCGGGCACGGTGGCGGGCAATCTGGCCAACGACGACATCACGGTGG
CGGGCATCTCGGTCAACATGATGTTCGGGCTCGCCAACAAGACGTCCAACGACTTTTCACACTTTCCGTTTGACGGCATT
CTCGGGCTCAGCCTGAGCAAGGGCGTGACGAACAATTTCTGGCAGGTGGTGATGGACGGCAAGCTCGTGGACTCGAACAT
CTTTGGGATTTCGATCTGGCGCGACTCGGACGGCGGCAGCAACAACGGCGAGCTGACGATTGGCACCACGGACAGCAGCC
AGTACACGGGCAACATTGGCTACACGGCCGTAGACTCGAGCGCGAACGGCGACTGGGCAATCGCGATGGGCAACATCGGT
TTTGACGGCAGCCTTGCGGGCGTGACAGACCGGCTGGCCTACATCGACACGGGAACGACGTACATGTTTGGGCCGAAAGA
CGACGTGGCGGCGCTGCACGCGCTGATCCCGGGGGCGTCGACCAGCGATGGCGGCACAACATACACGGCACCGTGCAACA
CAGACCTGCCGCTCACAGTGGTGTTTTCGGGCGTTTCGTACAACATCTCGTCGGAGGACTGGCTGTCGAGCGGCAGCAGC
GGCAACTGCACAAGCAACGTGTACGGCCGCGAGGTGGTGTCGGGTGCGTGGCTGTTTGGCGACCTGTTCCTCAAGAACGT
CTACACCGTCTTTGACGTTGACAAGACTCGCATTGGTACATTATTGTTTCTAGTATCTCTACGCCTGCTCTGGCCACCTG
CTAACAGACTGACCCGACAGGCTTTGCGAAAAAGTCGAGCTCAAAGGCGTCCTCGACAGCCAGCAGCACGTCGGGAAGTA
CGGTGTCATCGACTTTGGCAGGAAGTGGTGCGACATCGTCTTCTGGGAGCAAGGCAACAGCGACAGCGGTGGCGGAATCT
ACGACGGCCCCGACGACGCAGAAGACGTCTTCGCCTGCGAGTCGGTTGGAGGGAAGCAAGGTCGCCACAGTGGCATGTAT
TGTGGCAGGTATCGTTCTGGCGGCTTGAGATGAAGCGGACTGGAGAGCAGTGTCGAAGAGCGTTTCGATGGAATAGATTG
AAGAGGAACTTAAAACGTAGGCCTCAATTTTCACTTGTAACACTATTTAATGTAAGATAGATCTGAGACGATATAGCGCA
GAAATTGCACAACGGCGTTGACTTCTTGGCCTGAATACGGTTTCCGATGGGCGGGATTAGTTTGGAGTTCAGTGCAGAGT
CACGTGCAGAAGTGGAACAAGGAAGCTAAACACGGAGCTATTACAGCCGGGCCATTCAGCAAAGGCCAGCGGCTCTTAGA
GCTTCAAAGTAGTCAAACCACGGCCAAGAACGAATGGCTGCGGCAAATCCGGCACCACACCGACACCCACAACCACAGCG
AGCGACGGATAGCACGAGCGAGCGGCCGACTGTCTGAGCGACGGACCGACTTTTGATTTTGTCTGCCGTGGAGGAAAATG
CGGTGGTAGCCGGGGGAGGAAGAATTCGAAACAACCAAGGCACAAAGGGGACAAAGGGACAGATTGTCAGGCGGCTGTTT
TGGGGAGCGACATGGCAGGGGCACAGCGGTTGTCAGCGGGGGATGGCGAGGAGAGCGTGGGCCTGCTGGCATCGGGACCC
GGGGGAGACGAGGGTTTGGCGATGCAGCCGGGCAGCAGCGACGATTCGGTGAAGCGGGCGGGCAGCGTTGGACTGGGGCT
GGGGCTAGTGACGACGGAGATGTCGGTGATCGGAGGGGAGGGGCGAAAGGGGGGGTGGTGTTGGTGTTGGTGGCAGCGGC
GGCAGCAGCGGCGGTGTGGTGCGAACGAACAGCGGCGGGCTGTCATCGCTGCGATCGCCGCTGACGCCGCGGACGCCAAA
CCGGGTACGATTTGACCTGACGCCACAGGTGGCGGACTTTCCGGTGCGTCTGGGCGACAGCTGGCCGGCGGACGGGCGGC
GGAGCCAGGACAGCAGCGGCAGCGAGGGGTATGGCGGGCGTGACAGCTTTGACGTGGACGTGGGGGCGGAAGAGGCGGCG
CGCCAGCACCGGCTGCCGCTGTTGACGGGCATGGAGGCGCCGACGGTGGCGACAGCACGAACGGGCAGTTTTCTGGGGGG
CGATGACGGCGACGACGGCGACGACGACAGAGCCGGCGGCGATCCCGAGCTCTGGGCGGCCCAGGAACGGCGGCGGCCCA
AGTCCGGACTCGGCAGCGCGTTTATGAACATGGCCAACAGCATCATCGGGGCCGGGATCATCGGACAGCCGTACGCGTTG
CGGCAGGCCGGACTGGCGTCTGGCGTGGTGCTGCTCGTGGCGCTCACGGCCGTCGTCGACTGGACCATCCGGCTGATCGT
CGTCAACAGCAAGCTCAGCGGCGCCAGCAGCTTCCAGGGCACCGTCGAGCACTGCTTTGGCCGGCCCGGACTCGTGGCCA
TCAGCCTTGCCCAGTGGGTCTTTGCCTTTGGCGGCATGGTCGCCTTTGGCGTCATTGTCGGCGACAGCATCCCCCACGTG
CTGCTCGCCATCTGGCCCGCCCTGCGCGATGCCCCCGTCGTCGGTCTGCTGGCTGACCGTCGCGTCGTCATCGCTCTCTG
CCTCGGCACCGTCTCCTATCCTCTCACGCTCTACCGCGACATCGCCAAGCTGGCCAAGGCCAGCACCTTTGCCCTCGTCA
GCATGTCCGTCATCATCGTCACCGTGCTCGTCCAGGGCGCCCTGGTACCTGCCCAGGACCGCGGCTCCTTCAGCCGGCCG
CTGCTGACCGTCAATACCGGCATCTTTCAGGCCATCGGCGTGATCTCGTTTGGTGGGTGCTCTCCTCTGGTTCTCTGCCA
ATGCTTACTAACATGTTACTAATCAGCCTTTGTCTGCCACCACAACTCCCTCCTCATCTACGGCTCCCTCAAGACGCCGA
CGATCGACCGGTTCGCCCGCGTGACCCACGTGTCCACGGGTGTCTCCATGGTAGCCTGTCTGATCATGGCCCTGGCCGGC
TTCCTCACCTTTGGCGACCGCACGCTTGGCAACGTGCTTAACAACTTCCCAGCCGACAACACGATGGTCAACGTGGCCCG
TCTCTGCTTCGGGCTCAACATGCTGACGACGCTGCCGCTCGAGGCCTTTGTCTGCCGCGAGGTCATGTTCAACTACTTCT
TTCCGGGCGCGCCCTTCAACATGCGCCTGCACATCCTCGTCAGCACCGGCCTCGTCGCCGCCGCCATGGGCCTCAGCCTC
GTCACCTGCGACCTCGGCGCCATCTTCGAGCTGGTCGGCGCCACCAGTGCCTGTGCTATGGCCTACATTCTGCCGCCGCT
GTGCTACATCAAGCTGACGACCCGCAGCTGGCGCACCTACATGGCCGCAGCCATTGTCGTCTTTGGCTGCTCTGTCATGG
GCATCAGTCTGCTGCAGGCCCTGCATAAGATCATCAAGGGTAGGCTTGGCCCCCGTCTGCTTATCGTTCTGTCACGCTCG
TCAATTGTCCACCCTGCTAACCGCTCAGGCGAAGGAGGCACGGCCCAGTGCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62