GenePrediction:GLEAN_5339 Details

Name: GLEAN_5339
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:311755..309927 (- strand)
Length: 1829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:311755..311720 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_97:311660..311069 (- strand)
Length: 592
Type: CDS
Source: GLEAN
Position: GCSC_97:310870..310623 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_97:310451..309927 (- strand)
Length: 525
>GLEAN_5339 class=GenePrediction position=GCSC_97:311755..309927 (- strand)
ATGGGGTCATTCGTCTTGGACTTTTCGGCATATAACGTAAGGAGTTCTCTACTCTCCCCTAGATCTAATAAGCTGACCGG
GTTCCCTGTTTCTAGGCCCTCCTCTCCAGCAGCGGCCATAATGGCTCTTACTATGGTGCTGACGACGCCTTTTTCGGCGG
TGGTGACCCTGGAATGGCTAACAACGCAGCCGGCCGGCGTCACCTCCACCAACAGCACCACAGTCAGCAGCACGGCCAGC
ACCATAACAACAACAGCCGCTATGCTGTCTTTGACCGCAACTCCGTGACCCGGCTCGATGCCGAAAAGGCCCTTCAAGAT
CGGCGCAACCTGCACATTGCCAACTTTGGCGCGACATGGCTCAAGCCGCCTGGTGTGCCGAAGACGCTATTTCAGATCCG
TGAAGAGCTGCGTGAGCAGGAGGAGCAGGCCGAGACCGAGCGTCGGGAGGAGCTGGCCCAGCAGTTGGCCCAGGCCGAGG
CAGAAGCAGCTCTGGAGGCAGAGGGTGGCATCGGGATGGACGAGATGGCCGTGGGTGGCGATGGCATCGGCGGGGACGAC
GAGGGAATGGGGGTGGACCTGGATGCCGACATGGGAGAGCAGGATCTTGACGGCGAGATTCCCGATGGCGACGGGGAGGG
ATTCAGTTTTGGGGATGATGCAGAAGACGGTGATGATCCATTTGCGAGTTCGTCCGAAGAAGAGGAAGAGGAAGAGGAGG
AAGAAGAAGAAGAAGAAGAAGACCCCTTTTAGGAAGAAGAAGAAGAAGAAGAAGAAGACGGCAGTAGAGAGGACAGAGAA
GAGGAGACCAGAGAGGAGGAGGAAGAGGATCGGGAAGACGAGGAAGACGAGGACGAGGCGACGGCCAGCACGGCCATTGT
GCGAGACGAGTCCGGCAGACAACAGGCGGGCATACCCGTTACACCGGTGCAGAACCTGCCGCCACGTACGCACGAGGAAG
ATTTCCGAGCGCGAGCGGCAGAGCGGCGCGAGATGCGCCAGATGCGTGCCAACGAGGATCGCGTTCGAGCCATGCTAGCC
CAGCCGCGGCTGTCGGCCATTGGAGGGCTGTACGATGAGGTTGGCGATCTGGACGAGGAGGACGAGGCGCAGATGCTGCA
AGAAGACGACCTGGTGCGGGAGAGTGGTGGCGGCGGTGGCGGCGGTGGCCCCGGTCGTCGCAGGAGAAGCGGCGCTGCAC
GCCGTCGTTCGACGCGACAGCCACGCCGCAGCAGCTTGAGCAACAACAACGGCGGTGGTGGCGGTGGCAGAAGCAGCATC
GGCGGCCGTGCTAGCCGCCGACAGGCAGGGAGCAGGGTCCGCAGCAGCCTGGGCGAGTTTGACAACGAGCAAGAGATCGT
GGACACCGATGGAGGTGGTGTTGGTAGGGATGGTGGTGTTGTTGGAGGTGGAGGTGGTCCTGCTAGCGATGGCGGCGATG
ATGACGACGGGCTGGAGATGGACATGGATGCCGACATGGACGATGGGATCCCCGATGCATCCATGCTCAGCATTTTGGAC
GGCAGCTATGAGCACACCGACACGGATGCTGAGCTGAGCAGCATCGACGGTGACGACGGCAGCAGCAGCGCCAGCGACCG
TCATGTCGACCACACCCAAGACGATCGCGACGATGGCGATCTGCCGCGTCGCCTGGGCCGAGGGGCCACTATCAGCACGC
CAGCCGGCACCACTGCTGCCGATACAGCGCATCGTCGGTATCGCAGCAGTCTCGTACGCAGCGACCGCGACAGCCTGGAC
ATCAGCGGACTCCTGTCGCAGGACGGCAGCAGCAGGATGGACAGCAGTCCGGCCATACGGCGGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62