GenePrediction:GLEAN_533 Details

Name: GLEAN_533
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:447702..448025 (+ strand)
Length: 324
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:447702..447764 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_97:447818..447902 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_97:447988..448025 (+ strand)
Length: 38
>GLEAN_533 class=GenePrediction position=GCSC_97:447702..448025 (+ strand)
ATGGCTCGTGGCAACCAGCGCGAAAAGGCGCGTGAGAAGAACTTGAAGCAACAGGCAGCGCAGGTAAGCCTGGCCCTGAT
AGACAGACCAGACTCCTATTCTAACGTCACATCTAGAAAAAGGGCAACTCCAAGAGCGGCAGCGAGATGCAGCGCGAGCG
TGAGGCCCTCGCCCTGAAGATGCGGGAGAAGCAGGCTGCTGGTAGGCCGAACCTTTGGACCCATGCCCCTACTCTGCCCC
TTTCCTGGCTGGTCGTGTCCGATTCTAATTCTCTCCAACCATGTAGCCGACGCAAAGAAGTCTGCCGAGTCTGCTGGCAA
ATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62