GenePrediction:GLEAN_5340 Details

Name: GLEAN_5340
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:301879..298279 (- strand)
Length: 3601
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:301879..301561 (- strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_97:301450..299520 (- strand)
Length: 1931
Type: CDS
Source: GLEAN
Position: GCSC_97:299466..298279 (- strand)
Length: 1188
>GLEAN_5340 class=GenePrediction position=GCSC_97:301879..298279 (- strand)
ATGGTTCTGATCCAGAGCCACCCGATCCTCGAGAGGTTCCGGAACGCGCGGACGCCCGGAGACCGTATCCAGGCCCTGCA
GGCCCTGAAGAACGACACGGTCGGTCACGTGCTGAAAAAGAGCAGATGGGTCGAGCTGGGCGTGTTGCGGCCAGTTGTCC
GCTGCGTCGGGCTCTCGCGATCGGCCAGCCGACACGGTGACAGCCACGGCCGTCAGGACAGCAGCCGGCGGCCATCGTCG
GCTACGCCGCCAGACAGCCTGTCACAAGTGGACCTGGCCCGGCTGCAGGCTCTCGAGCTGCTGGGCGTATTTGCCAGTGG
TAGGTTTGCCTTTTTCTTTGGTCATCTAGTCTCCGGAGTTCTATAAGCTCTTCCCTCTTCCCTCTTCCTTCCAGTCTTCC
ATGAGGCTATCCTTCTGACGCATCAACAGGCGGTCCGTCCTTCCTCGCTCCTCTTCACGCGGCCGGCGCGTTGCCAGCCA
TTTTGTCCTGCATCGACCCTCTCACAAGCCACCCACGACTCGTCTATGCGGCTCTGCGGGCTATGGTCACCATGTCCAAG
GCGGCCACGCTGGTCAACTCGTCGCCGCTGTCGGCTGCACCACCACCGCCCCTCACTGTGGTCACGCTGGCCGACGCGCT
CTTCTCGAACCATCACCTCGGCGCGCTGCACAACATCATCTCGGCGCCCCAGCAGCAGCAGCACTGGTGGGCCGAGTCGA
TCGCCAACATTGCCATGGGCCTGATCGGGCCGCTCTGCCGCGAGGAACGGCACCAGGTGGCGCTGGCCAATGCCGGCATC
CTCGACGACCTCGCCGTCAAGGTGGCGAGCCTCGTGGTGGCACGCGGCCAGGTGATTCCGGGGGCCGAGATCACAGCCGA
GAAGGAGGGCCTGCGCGAGGCGATTCCGGAAGCGGCGTCGCCGCGGATGGACGTGGCGGCGCTGTTGTTGGCAGTGACGG
CAATCGTGGGCGACTCGAGGCTGCGCGCCTGCATGATGCTGTACTCGCCGTCGATCCTGGCCATCTTTCCGCAGATCGCG
TTTGAGAGCTCGGCCAACGACATTTACGCGGCGTGGAACGCGCTCTGTATGGGCGGACTCAGCAACCTGCACGAACAGCC
GCTGGGGGCACTGGACCTGCTGCTACCGGCCATCCCATCGCAGCAGTCGCGGGCGTACTTTGCCCAGAGCTCGCCGTTCC
CACCGCTGGGCGTGTCCCTGTCGCGCGACAACCTGGCGGCACTCGGACTCGGCGGTAGCACCGGCAAGCGCTCGGGCTCA
CATAGCCAGCCACTGCCTGGTTGGGCCGTGATGTCGCGCGAGTCGACTTCGCCGCTGGCACCTGAGTGGGAGGCTGTCGA
GGCCGAGAGCCCCATGATCCCCTGGCTCCTCGGCCTGGTGCGGTCGTCGTCCGGCATGATCCGGCTGGCGGCCGCGTCCG
TTCTGACGTCGCTGTTTCGCGCCCAGCTGGCGAGCAAGTCGCGTGAGGCCGCCATGGCTCTGCTGGTGGTGCCACTGCTC
CTGCGCATGCTCAGCGACGCGGCCACCAAGGGCATCGGCAACGGCAATGGCGACGACGACAACACCGTGACCGAGCAGCG
TGCCATCACGGAAACGGCGCTGACAGTGCTGGCACGGCTGGTAGCCAACAAGGAGGTGCTGCAGAAGGCGGCCGTCGATT
GCGGCGCCACCGGGATCCTCGCCAAGCTGCTGAAGGAGTCCTACGAGCCGTCACCGAGCCGATCCCTGCTGCGGCCGTGG
AATCCAACGCCGGCTCCGTCGCGGACGGTCACGCCTGATATGGCCAGCCGCGGGGGCAAGAGCGACGAGGATGACGACGA
CGACATTGACAATGAAGAAGACGACAACGACGCACGTGCCAGCAAGCTGGGCCCGGTGGGACAGAACGCGCTGCTGGCCT
ACCGGATCCGCCTGCGGGCGGCGACGCTCAAGGCGATCGCAGCGCTGATCGCGTCAAAGTACGACTACCAGAAGCGGTTT
GTGGAACAGGAGGTGATGCCGTACGTGGTGGCTTCGCTGAGCCCGACACCGTGCAAGCCGCGAAACGCAAAGGAGCCGAT
GAGGGTGCCTAAGGACGGCGAGGCGGCGGCGGCGGGCGGCGGCGGTGCAGACGAGGAGGTCGACCCTGAATACGGCCGCA
ACCCGGTCGATGTCCTGGTGGCGGCGTGCAACTGCGTGCGGATGCTCTCGCGGTCAATAGCGATACTGCGGGTGACGCTC
GAGGATGCCGGCGTGGCGGCACCGGTGCTCCGGCTGCTACGACATCCAGAGATCGAGGTACAGAACGCGGCTACGGCAGT
GGTGTGCAACCTGGTGACGGAGACGAGTCCGATGCGAGAGGTGAGTGTGGAAAGCCAGGAAGGAGGTTGGGCCAAGCGCG
CTAATATCTACAGCAATTCGCCGAGGCGGACATTATGGGCATCCTCTGCGGCCACGCACACTCGCACAACTCGTCCCTGC
GGCTCAACGCGCTGTGGGCGCTGAAGCACTTTGTGGATGGGGTCGAACCGGAGCGGAAGAAGGCCTGCCTCGAGCAGTTG
GGCTCGGGCTGGCTGGTGCGGCTCATTGCCCCCGGCATGGAGGACGAGCCGTCGCTGTTTACGTGGGCTAAGAGCGGCGG
CAGCAGCAGCAGCAGCAGCAGCAGCAACAATAACAACAACAACCACTCCTCGATGGACGAAGATGTGGTGATGGACTTGC
CGGATGTGGACGACGACAACGATGAGGACGACGAGGACGAGGATGATGAGGACGGCATCGAGGTGGCGGTGGCAGCAGCA
ACAGGAGCCGAAGTCGCGGGGCGGGCGGTGTCGTCGTCGCTGTACCGGGCTCGGTTTCCGCGAATGAGCCACGAGCGTAG
CCGGACCGGGCGGCTGCGGCAGGCGGAGGCGAAGCTGGCAATGCTGCGGGAGGTGGAGCTGGCACAGCCGCGCAGGCACC
CGAATCGGAGCGACGACGTGGAGATCCAGGAGCAGGGCCTTAACCTGATCCGCAATCTGATCGGGCCCGGGCCCTCGGCA
GGCGGATCGGCCAACGACGCGCTGCGCGAGACGACAGACATGATCGACCACCTCTTCAGCGAGATCGGGCAGGACCGGCT
CTTCCAGATCCTGCTGTCGAAGCTGCGGACGCGCGTGCTGCACGAGAGGGGGGGCAGCAACATGGGCAGTGGTACTGCTA
GCACGACCGGCACGACCAGCACGACCAACACGACCAACACACAGGCCCGGGTGCTCTATCCGCACACCAAGATCGTGGAG
GCGGTCGTGTTCATCATGGTGCATATCTCGGCGAGCGTGCCGCGGCACCGGCAGCTGGTGGTGGCGCAGACGGAACTGCT
CAAGGCGCTGGTGGCGCAGTTTGGTAGCCGTAACAAGGGCGTGCGGCTGGCGCTCTGCCACCTGCTGTCGAACCTGACGT
GGCGCGAGGATGCGGCCGACACGGCGTCGGTGTCGCTGCGGACGCTGGAGCTGAAGCGGCTCGGACTGCTAAACCAGCTG
CAGGTGCTACAAGAGGAGGACGTCGAGCTGGACGTGCGAGAGCAAGCCAAGATGGCCATCCACCAGATGGGGCGGGACTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62