GenePrediction:GLEAN_5343 Details

Name: GLEAN_5343
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:287772..285028 (- strand)
Length: 2745
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:287772..286326 (- strand)
Length: 1447
Type: CDS
Source: GLEAN
Position: GCSC_97:286031..285700 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_97:285270..285028 (- strand)
Length: 243
>GLEAN_5343 class=GenePrediction position=GCSC_97:287772..285028 (- strand)
ATGCAGAGCGAGAGAGAGCAGCGAAGTAGGGCGGCACGCAGACGCAAGCACGATTGGACTACTGCAACGACGAACACCAG
AGCGGTCGACGGGGACATGGTAATTGCTGGGCCCTGTTGCGGCTGGCCGATTTCTTCCTCGCTCCTCCTTCGTCACGGCA
GACCGGACTCGCGTGCGTCTACGGATGAGCGGCAAGAGCGCGACCAGAGACGACGACGCGTGGCGAGAGAGAGAGATCCG
GGCAGCGCGCACACCGGACGACCGCCCGAGACGCGCACATACCACAGCATGTCGGCGCGGGACCGTCACGCGGCCGAGCC
GGTGGCCGACCTCGTCCGTCGCCCCTTTTCCTTTCCGGGGAAGCGGGAAAAGGGGAAGGAGGAGAAGGGGCGAGAGAAGG
GGAAAGAAAAAGAGCAGAAGCGACAAAAAGAGAAGGAGCTGAAACAAAAGGAGCAGCAGCAGCAAGAAGACCACCATCGC
CTCCGCTCACGCTTTGTCGAGGGTTCCATGAGCGACCGAGCCAGCGCGGCACCACCGGTCGCCTTTCTGGGTCCCGAGGC
CGTCAGCGCCTTTTACGCGCCGCCCGTCGTCATCGTCGGTCCGCCGGCCGAGTGTCAGCCGGCGTACCCGCGCAGCTCGC
TGCAGTCGGGCACTGGCAGCACGGGCAGTTTCGGCAGCGGCCTCAGCGGCCTCAGCGTCGACAGCGGTGACAGCGGTAAC
AGCAGCACCAGCAGTCGGCGACCGGCCAGCTTTCTGGCACCGCTCTTCGACGGTGTCCGGTGGCTGCACTGGCGACGACG
AGGCGGCGGCGGCGGCAGCGGCGAGACGGCGACGATGTCGAGCGGGCCAACATCGGCTCCCACAGCGGTGCCAGCAGGCG
GAGGTGCCGTCGACCAGGCGACCGACCAGACGACCGACCAGACGACCGACGTGCGTCCCGATGTGCGTCTAGCAGCCTCC
CCGCCGGTGTCGGGCTATCGTCCGCCGGCCGGCCAGCCGTCGGCCGAGGAGGTGCTGGCCAACTACCAACAGCTGATGCA
GTCGGGCTTCTTCCGGGATCGAGCCATTCCGGCGACGCGGTTGGGACTCACGCGCGGAGAACGTGCCGAGTCCAAGACGG
GCGACTTGGAGCCCATGCCCCAGCGCACCGCCGACGACGTGCTGGCCGTGCTGGCCCAAAGCCTTGCGGGCGACGGCCGG
CCAGCAGCGGCAGACGTGCATGATGTGCAGGATGTGCAGGATGTCCAAGACTCCCAGGACCCCCAGGACGACCCCCCAAC
CATCGTCCGGCGCGGCACCAAACGAGGCCACGCCGACGTCGAGCCGGCGGCCGCTGGCGGCGAGCGGTACAAGGCCGACA
CCGGGCGGGTGATCACGACGGCACGCAGCCGCGGCAAGCTGGTGAAGAAGCTGCGCAGGACGACCAGTCGGACCGATTGG
GAGGGGGGTGTGGAGGGAGGGGAGAGGAGAGATGTGGGGAAGGAGGAGAAGGAGAGGGAGGAGAAGAAGATGGAGAAGGA
GAGGGAGGAGAAGAAGATGGAGAAGGAGAGGGAAAAGAAGGAGAAGGAGGCAAAGGAGAAGGAAAAGGAGAAGGAAAAGG
AAAAGGAAAAGGAGAGGAAAAGAAACGAAAGGTGGAAAAAGGACGGAGACCGGAGGAAAGACAAAGACCAAGAAAAGGAC
AGAGACGAGAGACAGGGCAGGCCCAAGGACAGAGAGCAGCACTCGTGGCGGACGCGGTCAGCCGGACGACACGACGCGGC
CGTGAGCGTGCATCAGGTGGTGCCACCGATGCGGCACATGCTGACGAGGAGCAGTCGCGGTGGCCTGCGGGAGCGCGAGC
GAGAGGACCGGAAGCGAGCGGAGGCAATCGCGGAGGCAGAGGCGGCGGCCGTGGCAGCAGCCGAAGCAGCGACAGCGGCC
GAGCTGCGCAAGAAGAGGCGGGCAGGCGGGGCTGTGATGGTGCACCAAGACGGCGAGGGTCGTCGAAGCGGAGAGGCACG
TCGCAGTGGAGAGATGCGTCGCAGCGGAGAGGTACCATCGTGGAGACGGGGACCACTGAAGGAGCAGTTCAAGGTGCAGA
AGGAGGCATGGGAGGCGAGAGAAAAGGAGAGGGAGGCGAGAGAGGCCAAGGAAGCCAAGGAAGCCAGAGAGAGGGAAAGA
CGACGGCAGACACAGGAGCAGACCCATCGACCGGTACAGGTACAGGTGCAGGTGCAGCGGCTGCGAAAGCAGGAGAAGCT
GCAGGAGAAGCTGCAGGAGCAGAAGCAGGAGCAGAAGCAGGAGAAGCTGCAGGAGAAGCTGCAGGAGAAGCAGAAGCAGG
AGAAGCTGCAGGAACAGCAGTCGAAATTGCCGTTTCAGCGACAGCTGCAAGAGAAGGAGAGGCCAAGGCAACAGAAGCAA
CCGCAGCAGCAACATAAAGCACAACAGCAGCAACAACAGCAGCAACATAAACTACAACACCACAACCAACAACGCCTCCA
TCATCAGAAACAACACCTCCAGGACACCCAGGACCTCCAGGACCACGACCAACACCCCGCCCCCCCACAGAAACCCATCA
GCTTCCACTACCCACTGCGGGCACGCATGCCGGCTGCGGCTGGTGGAGGGCCGATGTCGCCGCAGCCGACGTGGCGCAAC
AGCGACCAGGACACGGACCAGCCGCTGCTGCTGCTCACAAAGCGCATGAGCTATGCAGACGCGGTGGAGAACGTGGAGAA
CATGTCGCCGACGTGGCAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62