GenePrediction:GLEAN_5345 Details

Name: GLEAN_5345
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:278572..276052 (- strand)
Length: 2521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:278572..278351 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_97:276561..276368 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_97:276304..276052 (- strand)
Length: 253
>GLEAN_5345 class=GenePrediction position=GCSC_97:278572..276052 (- strand)
ATGGTCCCGCTGGAGAGACGGTCAAGACGACTTCGGGCCCCAAGGAGGCACGAGGACGAGTGCCATGCTCTATACGAGTA
CAGTTCCGAGCCGACCGGCTGTTGTATTGCAGGGAAGGACCTAAAGAGCGATCCCGTCAGGATACACTACGCCGATGCGC
GATACGAGCAGGGAAGCTCAACCGTTGTGCACGGCCCGTACTCCGTGCACGGTACTCATACTGTAGGATAGATGTGGCTC
CTGTCACCAGCAACTGCGTCATAGCCAAGGTCTAGTGCACGCACGGTACAAGTGCTCCCACAGCGCTGCCGACTTCGGGC
CGTCAGGCAGGAGCAGCGAGAGCGTTCTGTGGTGAGAAGAAGGAAGGGAGAGCCGGGTGAAAACTCTGCTGTGTGGAGAG
GCCCAATGTAGGATGGGACAGGAACGCCGGTAGTGTTGCCCGAGAGAGCGCCGGTCGCGACGATGCGAGCGACCAGTCCC
AGAACGAGAAGAATGCGCTCCAGTCCTCCAGTCCTCCAGTCCTCAGGCCCAGCAGCCAGTGCCGGGCCACCACGAGACAG
CACTCCCAACGGCACGTCGTCGGGTGTGCGCTGACGGCCTCGTCTGCAGCCGCTCGATGTATTTCTCGCAAGACAGAGAG
AGCCCGGAGTGCCCACTGGCCACGCACTGTGCCGCACCATGCATGGGCGCCGGTGGGGACAGGGGAAAGCTGGCTTCGCA
CGGCTCCATAAGACCCTCGCTAGTGGAGTTGACGTTGACAATGGCGGCACCGTCGTTAGGGGAGCCGGGTGGTGGTGGGG
GTAGGCGAGAGGAGGGGGGCAGACAAGGAATGCCGGAAAAGAGGCAGCGACGACCGCTCAGCCGCTCCGCCAGAATAGGC
AGTAGGCAGTGCGCCTATGTACATGGTAATGTGACCTGCGCATCCTTCTGCCGAACCTGTCGCGAGCCTCTCTCTGTCTC
CGATCGAGAGAAGGGCCAGGCGAACGGTCTGCATCTCCTTTCTCTTATTACCGCTATTAGTTCGCTAGCCAGCAGGCGAC
GACCTTTCCCCCCAAGGGATCTGCTTATAAAGTGGGCTACCAAGTCAGACGACCCAACGGTAGGAAAACGCGATTTCTCA
AAAAGGGATCTACCCTCTCTTGCAACACTTTTCAGTCTCTTCCTCCCGAAGCACGTGTGTGTGTATGTGTGTGTGTGTTT
GCTTTGGCCTCCTCGCTCTAGCCTGTCCCGCAAAGCAGCCGGAAGCAGACGCCAGCAGCATCCCAGCATCAGCCAGCAGC
CAGCCGGCAATCCGAGCCAGAAGAGAAAGAACATCATCCATTGCTCGCGCGCTTCGCTTCGCCTCCCCTCCCTCTTCTCC
GCCCCCGGACCTCAGTCGACCTTGGCAGCCGCACCCTTCCCGAGCTTCATCCCTCGCCTCTCGTCCTCGTCGGCGCGTGT
CATCTGTGCTCTGTCTGCTCGGTACGTCGCCCTTCTTGCCCCCCCTTCCAGTCCCTCCCAGCCGTTTTTTTCCTGTGCCT
CCATCTTTATCACGCATCGCCAATCGACCCCCTCTTGCTGTCTCTCTCCCTCTTTCCTATCCAAAAACGCGAGCTCAAAT
ACAAGGGTTCAAATAGTTCTGGCCCATGCATCCTCGCTGTTTATTTTATGTAAAAAAATTGTTAAAAAAGGCCGGCCGAA
AAGCGCGGGGTTTTCACTTTTTACTTCCTCTTCCTTCTTCTCCCATCGCGGCCCACCAGCGAAACAGTTACAAGCGCCTG
TTTCTGGTATGCGGAATCACCCGCCGACTACAGGGGGGGTCTGACAGTCTGATGCCGTCAGCCTCTACAAGGTCATGTGC
CATAGATTGCTTCCCGTCTCAACTTCTCTCTCTCTCTCTCTTCTCTACTGCCCCTCTTACTCGATCATATACCCCCCCTC
CGGATATCTTGGCCACTAGTTCTCTTTGCTCCGTCCTCTCCACTGCCCTCTGCTCATCTCCCTCAACGCCCGTTTCTGAT
ACACCACCCAGGCAGCCGTGCCAAGACAACGGCGAACAGCTTCATCCGCCATGGCCGACAATTTTGGAGAACATGTCGAC
GTAGGCACCTTCTCGCAGATCCTCGAATTGGATGACAGCCCACAAAACCGCGACTTCAGCAACCCGCTCGTCTACGACTA
CTTCACCCAGGCCAAGGAGACCTTTGAAAAGATGGACGAGGCGCTGTAAGCCGCCGCCACCGCCTCCTCTCTCTCCCTTG
CTCCCGGCCACTGACAGATTCATCTCAGGCGCGCAAAAGACCTCAACCAGCTCTCCGACCTGGGCCACTTCCTCAAGGGC
TCATCCGCCACCCTGGGGTTTTCAACAGTCCGCGACCACTGCCAGGTCATCCAGCAATACGGCAGAGGCACCACTCTGGA
CGGCTCTGCCGAGCCTGACCAGGACGTCTGCCTGCAGCGCATAACCGACGCCCTGGCTGCCGCCAAGCTGAACATGACCG
TCATCGAAGAAAAGATGAACGCTTTCTTCAACCAGAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62