GenePrediction:GLEAN_5346 Details

Name: GLEAN_5346
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:267362..265663 (- strand)
Length: 1700
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:267362..267342 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_97:267189..266844 (- strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_97:266790..266176 (- strand)
Length: 615
Type: CDS
Source: GLEAN
Position: GCSC_97:266117..265663 (- strand)
Length: 455
>GLEAN_5346 class=GenePrediction position=GCSC_97:267362..265663 (- strand)
ATGTCTGCGCCAAGTGATCCAGTAAGTTCGTACCCACTCAAGAGGAGGGCCCCCGACTTTATTATGCATAGCCGACAACC
GTGCTGCTCCTTGAGCTGCTCCTTGATTTCTTCTTTGGGCCTTCCCCCCTGTCTTCTCCGGCCTGTCGGCCTTGGCTGAC
AGCTCAAAAACAGAAAGCGCCTGCTCCAGAATCTCCCACGACGGCCCGGCCCCTGGAGATGGATGACGACGACATCACCG
AGTCCAACATCGTCCTGAGCAACAACGACGAATCTACATCGAAGCCAGCCACCGCCGACAGTAACAGTCCCAAACCCGCT
GTGGCTGCCATTTCCAGTAGTGTAGACAACGACACAGCCGAAGAACCGGCACCGCCGAAGCCGCCGCGCCCCATGACCGA
ACAACAGAAGAGCGAGCAGACGCTCAAGGATGCCTTTCCGACCGTCGAGATGCCCGTCGTCAGGGCTGTGTTGACGGCCA
GTCGCGGGAACATCGAGGCTGCTTTCCATGCTCTCCTGGGTATGTGCATCTCTCGCCTCCTCCTCCCTCGGCCTCCTCTC
CTGACCTGGCAGAAATGACCGATCCCGCTGCCATCGAGCAAGAGGCACCGCCGCCGCCGCAGCCTCCCCGTCCTGCAGCG
TACGGCCGCCTCTCCCCCAATAGCCAGCTGGCTGCCGACGAGCAGTACGCGCGCCGCCTGGCCCAGCACTACGAGAGCGA
GGGTGCCTATGAGAGCCGTACGAGCAGCTACGGTCCGCGCTCGGGCAGCCGTCGGGGCGATGGACCGCCGTATCCGCCAC
GCCCGCGCCCGGAGACCGGACTCAACCCCAACGAGCTATGGGACGACCGTGATCGCAACTTCCTGGACGACGATCTCCCC
GTCATCCGCGAGAACCTGCGCAAAGGCTTCGTCGAGACCCAGGCCAAGTTCAGCACCTGGTTCACCGGCATCAAGAAGCG
CATCGACGATGAGTTCAACGGCCCCGAGGACGATGACGAAGAAGGTCACCCAGGCAGCGCCCAGGGTCCACGGCCGCAGG
GCCGACCAGGCGGACCGGTCGGTGGCGGTCGTGGTGGCTATGGCAATTATCCCAGCCGGCAGCGAAGCCAGCGCAGCGGC
GACTACGATGCCGACCCAGAGCTGCTGTCTGACGACTTTGCCGGCATCAAGCTTCACGGCGACGGCAGTGAGTCTTTCCT
TTCTTCTTGTTTTTATGTGGACTTCCCTTTTCTGACAGACAACAGCCCCCGTGCAGGCGAACAACCCGAACGCGTTCCGG
CCACCACCACCGTCCACGTCGCCCCGTCCGGGCTCCGACCGCAAGGTGGCCTTCCGCGGCAACGACGAAGTGATCGACGT
CTACAGCGCGTCGCCCCGGATGTCGGCAAAGGACGGAACATCGCCCACGGGCGCCGGCAGTGCAAAGGCCAGCAAATGGC
AGCCCTTGTCGGCCGTCGACCCGGCACCGATCGGGGATGCCGACCCGTTCAGCCTGGGCGACAGCGACGACGAGAAGGAT
GTCAGCCACAACATCAGGGGACCGGCTGAGGTAGCCGAGAAGACGGACAAGTCAGCCACAACGACCTCTGACGCGGTGGT
CAGAAAAGCATCCTCGTCGCCAGAAGACGCAGAGCGGCTGCGCAAGGCCGCAGCTGAAGCAATGGCAGACAGCCTGGTGG
AGGACAAGCCGAAAGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62