GenePrediction:GLEAN_5347 Details

Name: GLEAN_5347
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:261239..259099 (- strand)
Length: 2141
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:261239..261018 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_97:260958..259099 (- strand)
Length: 1860
>GLEAN_5347 class=GenePrediction position=GCSC_97:261239..259099 (- strand)
ATGGCAGACCTCGAGCTAGGGGCGTCATTCATCCCGATACTCTACAAGCCGGCTGCCTTGCTCCCCATTACCAAGCATCG
TGAGAGTCTCTTATACGTCATTGCGACGTACCCAGTAACCATCGTGGTCGGCCAGACAGGTTCTGGAAAGACGACCCAGA
TCCCACAATATTTGGAAAGGGCTGGATGGTGCAATGATGGAAAGGTGATTGCGATCACACAGGTAGGCATCTTTCCACCC
CTGGTATTCGAAGAGAGAGAATCTCACGCAGTTCTCTGTAGCCCCGGCGAGTTGCAGCTACAACGGTTGCGCTGCGAGTG
GCCGAAGAGTTTGGCTGTGAGGTTGGAAAAGAGGTTGGCTATTCGATCAGGTTTGAGGATGTCACCTCAGCAGCCACACG
GATCAAGTTCATGACGGACGGGCTTCTGATTCGCGAAGCCCTTGTTGACCCACTGCTCTCTCGCTACTCGGTCATCATGG
TCGACGAAGCACATGAGCGGTCGATCAGCACGGACATACTGCTTGGGCTTCTGAAGAAGATCCGAAAACGGCGGCCGGAG
CTACGTATCATCATCAGCAGCGCCACCCTGCAGGCGGACGACTTCATCGCCTATTTTTCCGCCTCGGAAGAGGGCAGCCA
CGGCACCAAGAGCAAAGCGGACGAGACCGAGATGGTGGACGATGCCGACGAGAGCAAGATCGGCACGGTAGTCAGCCTCG
AGGGCAGGACCTATCCCATTGACGTCCTCTATGCCGAGAGTCCCGTCGAGGACTATGTGGAGAGAGCGGTGGCCACGGTG
CTGGCGATACACGAGCAAGAACCGGACGGCGACATTCTTGTCTTTCTCACGGGCCGCGACGAGATCGAGACGGCAGTGCA
GGCCGTGGCGGAGCGCGTGGCCGCGCAGGAGTCGCTGTCGGCGCGGCGCGCCCTGTTGCCGCTGCCGCTGTTTGCCGGAC
TGCCGACGGACGAGCAGATGTACGTGTTTGAGGAGGCGGCCGAGGACACGCGCAAGGTGATCTTTGCGACGAACATTGCC
GAGGCGTCGGTGACGATCAACGGCATCGTGTACGTGGTGGACAGCGGGTTCGTCAAGGTGCGGGCGTACAATCCGGCCAC
GGGCATCGAGACGTTGACGGCAACGGCGGTGTCCAAGGCGGCGGCAGCCCAGCGGGCCGGCCGAGCCGGACGCACGCGAC
CGGGCAAGTGCTTCCGGCTGTACACGGAGACGGCGTATTTCGGGCTGGCCGACACCAACGTGCCAGAGATCCAGCGGTCG
AACTTGGCGCCGGTGGTGCTGCAGCTCAAGGCGCTGGGCATCGACAACGTGTTGCGGTTCCCGTACCTGACGGCACCGCC
GGCCGAGCTGATGACCAAGGCGCTGGAGCTGTTGTACGCTCTCGGCGCGCTGGATGACTACGCCAAGCTGACAAAGCCGC
TCGGGCTGCGCATGGCCGAGCTCGCCGTCGAGCCCATGATGGCCAAGACGCTGTTGGCGGCCCCCCAGTTTAACTGTCTG
GGCGAGATGCTGACGATCGCGGCCATGACGAGCCGCGAGAGCAGCAGCAGCGTCTGGGTCGACGGCGGGCGCGAGGACCG
TCGTGGGCTCGAGTCGTCGCGGCGGAAGTTTGCGGCCGATGAGGGCGATCACGTGACTCTACTCAACGTGTACCAGGCAT
TTGTCACCAAGGGCAAGGGCGAGTCGCGGTTCTGCCGCGAGAACCGGCTGAACTTCCAGGTGCTCAAGCGTGCCGTCAGC
GTTCGCGCACAGCTGAAGCGATTCATGGAGCGCTTTGGCATCGAGGTGTCGGGAGAGCAGCAGCAACAAGACCATGAACG
ACAGACACGACCGCTGCCACAGCACGCCACCAACAAGGCGGAGCAGATCCGGCGCTGCCTTACGATGGGCTACTTTTCAC
AGGCCGCACGGATGCAGGCAGACGGCTCCTTTTGCAACGTGGCCGGCGGCACCGTCCTGCACGCCCACCCCAGCTCGCTG
CTGTTCAACCGTAAGGCCGACTGGGTCGTCTTCCACGAAGTGGTGGAAACGGGCGACAAGATATACATCCGGGACGTGAC
CAAGATCGAGAAGGCATGGCTGCTCGAGTACGCTCCTAACTTTTACCACACGGGCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62