GenePrediction:GLEAN_534 Details

Name: GLEAN_534
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:453360..455457 (+ strand)
Length: 2098
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:453360..453364 (+ strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_97:453444..453453 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_97:453547..453684 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_97:453745..454326 (+ strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_97:454387..455457 (+ strand)
Length: 1071
>GLEAN_534 class=GenePrediction position=GCSC_97:453360..455457 (+ strand)
ATGAGGTACGCATTGCACAAGGCGCATGCCTCTTTGTTTATCGCTCCTTGTGCGTGTCTCGCAAGCTGACGATGTGTTGA
ACAGCACCGAACAGGTATTTCAACGTCGCCCGCGACTCAACATGATCACATCCTGACTGTGTGAAATACACTGTGACCGC
TAACTGACCGTGCTCTTTTCTCTCCAGGTCTACTACATCGGTATCGATGTAGGGACTGGGTCCGCCCGGGCTTGTGTCAT
CGATGCATCTGGCGAGATCAAGGGACTGGCGTCCGAGGACATTCGGCTCTGGAAAGTGGCAAATGGCCACGAGGATACGC
ACTATGTAAATGGCTGCTCTCTCCCAAGCTGGACAGGCCAGATGAGCGACTGCTGACACAGCCAGGAGCAATCGACGACG
GACATCTGGAAGCACATCTGCGGCGCTGTCCGCACGGCTGTCGCCCAGGCTGGAATCTCCGACGATGGCACGGCGGCGAT
TCGCGGCATTGGCTTCGATGCCACCTGCTCCTTGGCCGTTCTCAGCCACGACACGGACGAGCCGATGAGCGTTGCTAAGG
CGCGGCTGGGCAAGGAGGACCCGGAGGATCGCAACGTCATCCTGTGGCTGGATCACCGCCCTCTTGAGGAGACGGATGCG
ATCAACGCGACTGGCCACAACCTGCTGCGCTATGTCGGCGGAACGATGAATGTGGAGATGGAGGTGCCCAAGGTGCTGTG
GCTCAAGAACAACATGCCGGCCGACGTGTTTGCACGCTGTAAATTTTACGATCTGGCCGACGCCCTGACGCACCTGGCTA
CGGGCTCGGAGACTCGCAGCTTCTGCAGCACCGTGTGCAAGCAAGGTTACGTCCCGGTTGGCGTCGACGGAAGTGTCAAG
GGCTGGCAGGAGGAATTTTTACGCGCGATCGGGCTGGGAGAGCTGGCAGACGATAATTTTAAGCGTGTCGGCGGCGTCAA
CGGGGTGGTTAGCCCTTGCATTTCGTCCTTGTTCATTCCCCCGTTTGATCTATGCTAACGCCGACAGAACGGACAGTATC
TCTCTGCCGGCGAGCTGGTAGGCCCGCTTTCAGCCAAGGCCGCCGGTGAGCTGGGCCTGCCAGCCGGCATTGCCGTCGGC
AGCGGCGTGATTGACGCCTATGCCGGATGGATCGGCACCGTTGGCGCCCGCGTCGACCTGGGTGGCGCCGATGCGGATGT
GGTCAGCAAGCCGGGCGCCAACGACATATCCCAGGCATTCACTCGCCTCGCCGCGGTCGCTGGAACATCGACCTGCCATC
TGGCCATGTCGCGGGATCCCTTCTTTGTCGATGGTGTTTGGGGCCCTTACCGTGACGTCTTGCTGCCCGACTTCTGGATG
GCCGAGGGCGGCCAGTCGGCCACAGGCGAGCTGATCCGCCATGTCATCGAGACGCATGCAGCATATGCTGAGGTGACGGC
AGCCGTTGCTGCACAGACGCAGAAGACTAATATCTACGACTACCTGAACGGGCGCCTACACGCGATGGCTGCTGCCGATG
GATCCCCCGCTGTCAGCTACCTGGCTCGCCACCTTTTCTTCTACGGTGACCTCTGGGGCAACCGGTCACCGCTGGCCGAT
CCGCACATGCGCGGCGCTCTCGTGGGGATCAGCAACACCAGCAGCAGCGCTGACGGGCTGGCGCTGATGTACTACGCGGC
ACTCGAGTTTATTGCACTGCAGACGCGCCAGATCGTCGACACCATGAACGCGGCCGGTCACCAGATGCGCAGCATCTTCA
TGTCGGGCAGCCAGTGCCGCAACGACATTCTGGTCGGCCTGATGGCCACAGCCTGCAAGCTGCCTGTGGTCATTCCGCGC
TACGACAGCGCGGCCGTCGTGCACGGAGCGGCTATGCTGGGAGCGAAGGCGGCCAGCGGTGGATCAGACGGCAAGACTGA
GCCGCTTTGGACAATCATGTCACGCATGACCAGTACTGGCCGCGTGGTGCAGCCGTCTGCGGACGAAGGCGAGACCAAGC
TGCTGCAGGCCAAGTACGAGGTGATGCTGGACCAATTCAAGACCCAGCGTGCGTATCGCAACAAGGTGAATGCGGCTGTC
GCAGGGTGGAAGAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62