GenePrediction:GLEAN_5350 Details

Name: GLEAN_5350
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:243431..240988 (- strand)
Length: 2444
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:243431..243383 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_97:243319..242878 (- strand)
Length: 442
Type: CDS
Source: GLEAN
Position: GCSC_97:242809..240988 (- strand)
Length: 1822
>GLEAN_5350 class=GenePrediction position=GCSC_97:243431..240988 (- strand)
ATGGCGAGACTGAACGAGCCCCCAGCGCCGGCAGATAGCCTCGACGCACGTACGTAGCACATCTGTCTTTCTTGCGGGAA
ACCACCTCTGCCACCCGGTTAACATGATCCAGTTCGACGACGATTCCTACGCCAAAACAGGGACATCGCCCGCATCAACT
CGAACCAGTCTCTTCGCATCCGGGGTCTGGAGAACGAATGCGCGCGTCTTCTGTCGGAGAACCTCAACCTCCGCGGCCAG
GTTCTGCACATGGAGAAGGAGCTGGATGAGCACAGTTCACGACGGGCCAATGATCATGCGCTGCAGTTGAAGGAGAAGAT
GGAGGTGCATCTCATCGAGTTGGGAGCCCTTCTCGCCGGTTTTGGACTCGAGCCTCCGACGAAGAAGCAGTCGCCCTCTA
GACAGCGACGGGAAGGCGGGCCGCCACGGAAGTCGTTGCAGCTGCAGAAGAGGCCACCACAGCTTTCGCCAAGTGAGGCC
GAGTCCTTGGCAGCACAGGAAGGCAGGCTGGCCCCTATATACGAAACCAAAACATATCCCCGTCAGACATTAAAGTATGT
GCACAGCCCCCCAACCAGCAGCGGAGAAGCGAGCCGTGGACACTGACCGCCTGATTGCTTAGTCGGGAGGAGATTCTCGC
CATGCATGCGGATGCCGTTGACGCCACCAATTCCCCTGAGTTGGGACCACCTCCAATTTCACGGCTGATCCGCGACGAGT
CCAGGCGATCGATGCCATCTCCCAGCAAGGCCGCCTCCCCCGAGGCAGCGCCGGTGGGGGCAGACAGCAGAGACAGAACG
ACAGCTTCTCCCTCTCCCGTTCCGTCGGTCGAATGTGGTGCAGAGATATTGTCGCTGCCAACACCAGATCCACCGCGAAT
GACGCCAGCCGTGGGCAATCCAGGGATGCAGTTGCCAGAGATGGACAAGAAGCTTCAGCCGCTACGAGGCAAGGCCGCCA
ACCGAAAGCTGGTCGACTCATCTACCGGATCTGACCTGACCGCCTCGAGATCCATTCCAGCCAACGAGAGCAATGCTGTA
CAGGTTCAAAGGGTCGGGTCGAAGAGAAAGTTTGCGGTGAGCGACGAGAACGCGGCGGTTCGGGGCATGAAGGCCAACAG
CAACGACAAGACCACGAACTTGGAAAAGGGCCAGCTGGAGAACAACCTACCGATACGCGAGCTGAAGAATCCGAAGGGCA
TAAGAGACCTCGCCAGCAGCCGCAGAGGCCAGACCGACAGCAATGGCGAGGGCAAGGGAAGGTCTGGAGCCAGAAAACCT
CTCGCCACCAAGAGCACCAACGATGATATCTCCTCGCCACGGAAACGTTCAAACGAAGACATGGCGGCATGCAAAAGCAG
TATCAACACAGACGCGAACAAGATTGGTGCAACAGCTGGACGGATGAGAGACCGGGTAAAGATGTCTGTCATGCTGGACA
GCCCAGATCTGCAACCACCTGTTGTGGTAGAGATCAAGGTGGACGATGTGGCCGATGGGAAAGAGGACAGCCTTGATATG
CCATCTGCTGCAGCCTTGGGCCTGGAGAACATGAGGCCGCTTTCCCCGTCTTCCCAGAGCGATTCGATGTGTCCCAATAC
GCCACCATCTGCGTCGTCTATGCTCTTATCCGAAAAGCCAACTTCTGCATCGGCTGGGGGTCGGGATACACCACCGCCAC
TAGATATATCGTCGCAGGGCGAAGTGTCCCGCCCTAGTAGACGAGCACGTGCTTCTGTGAGCTATGCAGAACCGAATCTA
CGCGACAAAATGCGGCGGCCGACCAAGGAGCTTCTCGATGCTGTGGCTGGAGAGGGTCGATATGTTCAACGACAGGGTCA
TCAAGGTCCGGGTGAGATTGAGGGAGGAAAGCAGCTGTTCCCGATGCCAGTATTAGCTGCCGACACGCCAGTGAAACTGG
AGATGGATCCTCCTGCGACCGAACAGCAGCAAGAAGGGCCGCAGCCGGTGCCCCTACGGGCAATCATCACAGACAGAAGG
AAGCGAGCCCCATTGGCCGGTGTACGAGAGGTCGAGAGCAAGCAAGCCGAACCGTCTGCCATGGCTGAGCTTGGCCACGA
GCCCGATCCCTACGAGTTCATGATATCCTCATCGCCCCAGTCTCGGTCTATCGAGTCAGGTGCAGTGGCGACAGAGGAGT
CGCGGTCGTCAAAGGGAGCCCGACGGTCCTCTGCCGCTGTTATTCGCGATGACGCCTCGGCTGCAGCAGAACGCAGTGCA
AGGACGTCGGCAACACGGAAGCGAGCGTCGATGGTGGCACCAAAAAAGGCGTGCATGCTGAGTGGCGATGACGATGAAGA
CGACCCTGCAGATTCGTCATATGAGCCTCAAGTCAGCAACGGCGAAGGTGAGGCCTTGGGCACCGAAGGGCAGACCCTAT
CGACAAGGGACAGAATCTCAAGACGGAGAAGCATGATGTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62