GenePrediction:GLEAN_5351 Details

Name: GLEAN_5351
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:239171..237481 (- strand)
Length: 1691
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:239171..238765 (- strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_97:238683..238058 (- strand)
Length: 626
Type: CDS
Source: GLEAN
Position: GCSC_97:237984..237626 (- strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_97:237564..237481 (- strand)
Length: 84
>GLEAN_5351 class=GenePrediction position=GCSC_97:239171..237481 (- strand)
ATGAAGCCCTTTGCCCGCCTGTATCGCCCTCCCTCTGTGCCGCGAAGCACCAACCCGCAGAGGATTTCCTTTAGTGCTTC
AGCGGCTACCGGCGGTCAGTGTGCGGGATTACTAAGGCGTACAGGCGCTGGCACAGCCAACATGGCCCCTCCTCGGTCTA
TGACCGACACAAGCCCCTCGGCCAGGCTGGCTGGAATTGCCCGACACCTATTAGCCGCCTCCTCTTCTCCGCACCCCATT
CCCGCAGCGTCTTCTCACCCATCAACACCGTCTCGCCACCAGCTTCATACTGCCTCCGCCGCCACACCACCATCCACCAT
GTCGTCCCAGCCAGAACACTCCACGCTGCTCATCCCGGGCCCCATTGAGTTTGACGATGCCGTCCTGCAGTCGATGAGCC
ACTACAGGTAGGATCACGAGGTGTGCCAATGGGCGGGGAGACTCTAGCAGGCCCCAGCTAACAATGGCTTTTTTTGCTTC
GTGTCCAGCGAGAGCCATGTTGGCCCCGCTTTCGTCTCAACCTTTGGCGACGTCCTTGCCAACCTGCGCAAGCTCTTCCA
AAACACGGACCCGACAGCGCAGCCGTTTGTGCTCTCGGGCTCGGGCACGCTGGGCTGGGATCTCGCTGCTGCCAACCTCG
TCGAGCCGGGCGAGGCTGTGTTGGTGTTGGGCACGGGCTACTTCAGCGACGGCTTTGCCGACTGTCTCCGCATCTACGGC
GCCGACGTCACCGAGCTCAAGGCCCCCGTCGGCAGCCGTCCCCAGCTGGCCGAGATCGAGGCCGCCCTCAAGGCCCGCTC
CTACAAGGCCATCACGGTCACCCACGTCGACACATCGACTGGCGTTCTGAGCGAGCTGCGCGACCTGTCGGCACTCGTGC
ACCGCGTGTCTCCCGACACCCTGGTGCTCGTCGACGGCGTCTGCTCTGTCGCCTGCGAGGAGATCGCCTTTGACGAATGG
AAGCTCGACGGCGTCGTTACCGCCAGCCAGAAGGCCATTGGCGTGCCGGCCGGCCTGTCCATCTCTCTCTTCAGCGGCCG
CGCCATCAAGGCCCTGGAGAGCCGCAAGGAGCCGCCGAGGGCCTACTTTGCCTCCATGAAGAACTGGCTTCCGAGTAAGT
CCTACTTCTCCCAGCCGGGCTCTGTCCTCTGTTCTCTGTCCTTTTGCTAACAAGTCTTCCCCGCCAGTCATGAGGAACTA
CGAGGCCAAGAAGGCATCCTACTTTGCCACGCCGTCGCCCCAGCTCGTCCACGCGCTGGACACGGCACTGAAGCAGATCC
TCTCGGTCCCCCTTGCCGAGCGCTTTGCCAAGCACAAGGCCGCGTCCGACAAGATCAAGGCCCACATTGCAGAGCTGGGC
CTCAAGCAGGTGGCTGAGAACCCCGACTACCAGGCGCACGGAATGACTGCCATCTACCTGCCTGAGACGGTCACGCAGGC
ACAGATTCTGCCCAGTCTGGCCAAGCAGAAGGTGGTGTTTGCTGGCGGCATCCACAAGGAGATCGCGTCCAAGTACATTC
GCTTTGGCCACATGGGTGTCAGCGTGGTAAGTTCTTGGCCGTCCCAATCATCGCATCGACCTACACGGCAGCTAACTTGC
ATCGCAGCTCCAACCCGAGAGAGGCGACATCGACCGCGCCCTCAAGGCCCTCGACACCGGGCTTGCCGAGTTTGGATACC
AGAAGGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62