GenePrediction:GLEAN_5352 Details

Name: GLEAN_5352
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:236493..232815 (- strand)
Length: 3679
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:236493..236428 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_97:236336..236162 (- strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_97:236072..235351 (- strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_97:235280..233972 (- strand)
Length: 1309
Type: CDS
Source: GLEAN
Position: GCSC_97:233917..233119 (- strand)
Length: 799
Type: CDS
Source: GLEAN
Position: GCSC_97:233055..232815 (- strand)
Length: 241
>GLEAN_5352 class=GenePrediction position=GCSC_97:236493..232815 (- strand)
ATGGCACCCACAGTGCCGGAGCTGGACGCTGTCGTGCGTGCCTTTTACGAAGGCCGCGGCGAACAGGTTCGTCTTTGACC
CTGCTCTTTGCCCCTCCCCCTCCTTCCCCGGAACCGTGCCCGAGCTGACAGCTGCCGGTCCTCGCCCCGGTCTCTAGCAA
AAAGCAGCCGAAAGTGCTCTGAACCAGTTCAAGGAAGATCCTGACGCCTGGCTCATTGTCGACCAAATTCTCTCCGAAGC
AACGTACCCGCAGACCAAGTTTCTAGCCTTGCAGGTCCTTGACCATGTCATTATGACAAGATGGAAGGTTCTTCCCCGCG
ACCAGTGCCAAGGTACGTGGTGATGTGAACATGCCAATATGCTGTCGGCTTGGAGACTAGACATCCGTCCGACCTTGTAG
CTTGCTGACCCGCCATTCCAGGCATCCGAAACTTCGTCGTCCAGTTCATCATCCAATGTTCCAGCTCTGAAGAATTGCTC
CGAGAGCAAAAGACCCTGCTGAACAAGCTCAACCTCGTCCTAATCTCCGTCCTCAAGCAGGAATGGCCCCACAACTGGCC
GACCTTTATAAACGAGATCATCACGGCTTGCCACTCGAGCTTGTCGATTTGCGAAAACAACATGATCATCTTGCGGCTGC
TGTCCGAGGAAGTCTTTGACTACTCTGCCGAGCAGATGACGTCCACGAAAACGCGCAACCTGAAGACCACCATGTGCGCG
GAGTTCTCGCAGATCTTCCAGCTCTGCTCGGAGATCCTGAACACCGCCACGCAGCCGAGCCTGGTCAAGGCGACGCTCGA
AACCCTGCTGCGGTTTTGCAACTGGATCCCGCTCGGTTACATCTTTGAGACGCCGCTCATTGATACCCTCCGCACCCGCT
TTCTTGAAGTGCCCGAGTTTCGCAACGTCACCCTGCAGTGCCTGACGGAGATCGGTGGACTGCAGACCTCTGGCCCCGGT
CAAGTGAGCAACTACGACGAGCAGCTTATCAAGATGTTCACCGAGGTCCTTACCACCATCGCCAACATCATCCCCTTGTC
GATGGACCTCAAGACCACCTACCCTCAGAGCAACTCGCGGGACCAGGAGTTTGTCCAAAATCTGGCTCTGTTCCTCGGCA
ACTTCTTCACGATGCACCTAAGCGTATGTTCCGTTTTTACCCTGTCTCTGGCCTTGCAACCGTTTTACTGACCTCGCGTC
TTCAAACGCACAGCTTATCGAGAACTTGCCAAACCGCGACTTTCTCACCCACGCCCATTTTTACCTCATCCGCATCTCGC
AGATTGACGACCGGGAAATCTTCAAGATTTGCCTGGACTACTGGCTCAAGCTGGTCCAGGAGCTCTACGAGGAGATGCAG
TCTTTGCCTATCACAGACGCTAACCCGCTCCTCGCCATGGGCACTCTGACGTCGAACGGGGCACCAAATCCAACATTGCT
CAACAATTACCCTCTAAGAAAGCACAAGTACAAGGAGATTCTCTCCAATCTCCGCATCGTCATGATCGAGAAGATGGTTC
GCCCCGAGGAAGTGCTCATTGTGGAGAACGACGAGGGTGAGATCGTTCGCGAGTTTGTCAAGGAGAGTGATACCGTGCAG
CTGTACAAGACGATCCGCGAATGCCTTGTCTACCTCACCCATCTCGACGTTGTGGACACGGAGCAAATCATGACCGAGAA
GCTGGCCCGCCAGGTGGACGGCTCCGAATGGTCTTGGCACAACTGCAACGTGCTTTGCTGGGCCATCGGCTCCATCTCTC
TGGCGATGAACGAAGAAACAGAGAAGCGGTTCCTGGTCACCGTCATCAAGGATCTGTTGGGACTTACCGAAATGAAACGC
GGTAAAGACAATAAGGCAGTTGTGGCCAGCAACATCATGTACATTGTTGGACAATACCCCCGCTTCTTAAAAGCTCACTG
GAAGTTCCTCAAAACCGTCGTCAATAAGTTGTTTGAGTTTATGCACGAATCTCACGAAGGCAAGTACCCCCCCATCAACG
ACACACCTGTTTTTACCGTCGGGCGCCAGCTAACTTTTGTTCCCATACTAGGTGTGCAGGACATGGCTTGCGATACTTTC
ATCAAGATTGCAAAGCAGTGCCGTCGTCATTTTGTCGCACTGCAGCCGAGCGAACACGAGCCATTCATCGACGAAATTGT
GCAGAACCTCCAAGCCGTCACCTGCGACCTCAGCCCACAGCAGGTACACACCTTCTACGAAGCGTGTGGCTACATGGTCT
CTGCCCAGGGCAACCGAAGCCAGCAGGAACGCCTGCTGGCAGATCTCATGGCGCCTCCCAATCTTGCTTGGGATGCGATC
ATCAAGTCCGCCACAGCCGATCCGTCGATTCTGCAGGACTCCGACACTATTAAGATCATTGGCAACATCATGAAGACGAA
TGTTGCCGCCTGCACGTCGGTCGGCCCGTACTTCTACCCCCAGATCGGGCGGATCTATCTCGACATGCTCCAGATGTATC
GTGCCACGAGCCAGCTCATCTCTGAAGCTGTTTCGCGCGAAGGTAAGGGAACAATCTGTACCTTGTGACTATAGCATATA
TTAATACCGCCTGCAGGCGAAATCGCGACAAAGATGCCCAAGGTCCGGGGGCTGCGGACGATCAAGAAGGAGATCCTGAA
GCTGATCGAGGTCTTTGTCGACAAGGCTGAGGATCTACAGTCGGTACGGACGCAGATGGTGCCACAGCTGCTAGACTCGG
TGCTTGTGGACTACAACCGCAACGTACCCGGTGCCCGTGACGCAGAAGTGCTGAAGGCCATGGCCGCTATTATAACGAAG
CTTGGCGGTCTGATGGAAGACCAAGTGCCGACTATCATGGAGAACGTGTTTGAATGCACGCTCGAGATGATCAACAAGGA
CTTCTCCGAGTTCCCGGAGCACCGTGTCGAATTCTTCAACCTGCTACGGGCTATCAACCTGCAGTGTTTCCCCGCTCTTC
TGAAGCTCGACAACCGGCAATTCAAGTTTGTGATTGATGCATGCCTGTGGGCGAGCAAACACGACAACCGGGACGTGGAG
GCTGCTGGACTGGGCATGTGCTTGGAGCTCATCAACAACGTGGCAGAGAAGACGGACACGGCTACTTCGAACGCGTTCTT
CAATCAGTTCTTCATTCTCATCCTCCAGGACGTGTTCTACGTCCTCACCGACACGGACCACAAGGCCGGGTTCAAGACAC
AGACGGCACTTTTGGTACGGATGTTTTACTGTATTGCGCCGGCAGATGGAAGCGCGCCCAAGATCCAGGGCCCTGTCTAC
CAACCCGACCAAGCCCAGCCAGGCACGAGCAACAAGGAGTTTCTTGCTAACTACGTCGGAAATCTTTTGCAAAATGCCTT
TACCAACCTGCAAGCGTGAGTTTGCCTAGTGGCCGGGTTGTCGTATATGTTGAAAAAAGCTAACGGACATCACCCCAGAT
CGCAAATCCAGTCTTTTGTCGAAAGCCTCTTCATGCTCAACACCCAGCACGACAAGTTCCGGCTGAGCCTGCGCGACTTC
CTCATTTCTCTCAGAGAATTCTCGGGCGACAACGCAGAGCTGTATCTGGCTGAGAAGGAGCAGCAAGAGCACGACGCGAA
GCAGGCCGACCTCGAGCGCCGGTCCAAGGTGTCTGGTCTTCTCAAGCCGTCGGAGCTGGAGCAGGACGACGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62