GenePrediction:GLEAN_5353 Details

Name: GLEAN_5353
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:229771..225673 (- strand)
Length: 4099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:229771..227682 (- strand)
Length: 2090
Type: CDS
Source: GLEAN
Position: GCSC_97:227482..225673 (- strand)
Length: 1810
>GLEAN_5353 class=GenePrediction position=GCSC_97:229771..225673 (- strand)
ATGTTGCCACAGCGATCCAGCAGCACCAGCAGCTGCGGGATGTCCAAGAGCAGGCGGTCGCCACTCATTTCCCTCCGTTA
TGAGGAGACTGCTCAGGCAGAGCTGCCCATCCCGCTGCCACAGCGAAACCCATCAAGGCTGCACCGCTCGCGATCAACTC
GCTCGATGGCAACAGTGCGGTCAACAGCCACAGCTGCCACAGCTGCCACGACAGCCACATTCGACATATTGCCAGTGTCA
GCCTCGTCCCCATCCTCGTCCCCACAGCCACAGTCGCAGCCGTCATCTCCTACGTCTGCATCGTCTGTGCCATCTATGCG
GCCCAAGACGTCCATGTCGTCACTGACATCGTCACCGACAACCTCACAGTCGGCCTCCTCGTCTTCGTGCTCATCACCCA
CCGTGGCCATGGCGCCATCGATGTCGGGGCCGCTTGTCATCCTGCGACCGCCAATGCTGATCGCACCACCCCAAGAGCAG
CACCCCGCTCTTCGCAGGCGTTCGATTCGACCCATTGCCGAAGAAGAGGGGGGTGCAGACGAGGTCTACGTTGGCCGCCG
CAGCTACGATCGCAACATCATCGCGTCCAAGCACGACTCGTTTCTGGCACCGTCGCCGTCAACATCAACGCTGCGCGTCA
ACCAGACGTGCTCGGAGACTGAGACTGAGACTGAGATCCACCGCACGGTGACGGCCAAAACCACACTGAAAAGCGGCCAC
GTCACGTCGGGATCTGCCGCCACATCATTGCCTGTCAGCAGGGCGGTGTGTGCGAGCCCAACGACAAGAGAGCCCGAGAA
GGCGTCTCATAAAGATGGCACAGCCGCTCGCGTTGCACCCGTCGCATCCGTCGGGAAATGTGGTATCGGACATACCAGCA
GGGTCAGCGTTGCCTCTGTCAGCAGTGTAACAACCACTGCGACCATGGTCATCAAGGCAGCCGCGCGAAACGCAGCGCAG
GAAAAGACGAGGGTCGCCCAGGCGAAGAAGCCCGAGGTCTCGCCTGCTCCGGTGCCAGCCGCGCCGGCGATTCGTGAACG
GACGTGGCATCTGTCAAAGGCCTTCAGCTTTCGGTCCAGTGCATCGGACAAGAAGAAGAAACGGCGCAGCAGGTTTGCAG
GCCTGTTTGGCTGTTCAGAGGACACAGCCAAAAGCAGCTGTATTAGTGGAGGTTCGGGCGAGATTCTGCCACCATGCACC
GCCCGCACAACAGCCACCCCGCCGGCAGACAGTGTGACTAAGCCCAGAGCGTCCTGGTCGATGCCGCTAGGACTTTCTTC
GTCGTCGGCCTCCACTCGCCAGAACGCGTCAAAGGCAGAAGATTGCACAACGACGTCAGGGCCCCTTTCCCCGGTCCACC
ACAACCCCTGCTCTGCTCTGGGCCCTCCCTCGTCCTCGTACTCGTCTTCCCCTTCCGCACTTCCTGCCTGCAGCCAAAAC
AAGCCCTTGTCGCCGACCCCCTTTATCTTTCGGGCACTGTCGATATCCGATCCACGACGAAAACATCAGTCTAGCAACAG
CAACGGCAGCAACCGCATCAGCTTTAGCAGCAATCGTCCCCACCCTCCCCCCAGCGCAGGCCCCGGTGTGTTTGAGCCTA
TCAGCACATCGATCCCGACCGAGACGCTTATCGAGAATGAGTTGTTGGCGGCGCTGACGTTTTCGCACCGTGGTAGTCTG
ATGCTCATGGGCCAACGCGCCGACGTCATGGGCGAGGGCGCGCGCGGCTTGGTTGAGGGGGGCGCGGCCGGAGAGGCTCT
TCCGCCGGCGATCGAGGTGGAGGCGGCTTCTGTGGCCGAACCGCTGCCGCCTCTTCCATCTGTGCCGCGTGCACGCCCAA
GACTGACGGAAGACGCCGAGCGCGAGTCCCACAAGGTGCGGTCGATGTACGACGAAGACGACGTCCTCCGCTGGGAAGAC
GGACAGCCGCCTGCTGCCGGCGACGACGACCCCGTCAGCCAAGACGCCCAGCCAAAAGGAGCAGCGACAGCACCGCATCT
GTGCGTCCTCACGAGCGAGCCGGCTCCGTCGTCTGTTGGCCTGCCCGAGGAGGCGGCTGAGGGCTATAGGAGTGAGCAGA
ACATTGCCGCGTACGGTTACAATTCCTTGCCGAGCACCTTGCACTGCCGTGTGGAGGAGGTCGTCTGCTGACGGCCAGCC
TCTTGTTTCTTGCCCAATTGCCTTCCTTGTCGTTTGTTTCATCTGCCCCAGCACCACTGCCATCACCACCGCCAGCGCGT
ATTGTGTGTTCCTTGTATTAAGACGTTTCTCTCTCTCTGCAACAAACAGTTCACGCACGCTGTCTTACCCCGCCTCGACG
GCCCGACACAGTCTGCATCCCTACGACAATGGCCTCCACCACTTTTCCGACGAAACCGAATCGAGACGAGCATCGATCGT
GTCCGTAGCGACGACCGTGTCCTCTACGGGGGCACCGTTGCCGAGGACCCCGTCGTTGCTGCTGTCGCCGCGATCAGCTG
GCTCGGACAGCGCCACGAGCAGCAGCAACAACAACAACAACAACAACAACGATAACAACAGCAACAACATCCGGCGGCAC
CAAAAGCAGCGCGGCCAGTTTGAGCTCGCTGGTGGCCTCGAAGATTGGGAGGATGTAGAAGTGGGGGACGTGGACCGGTT
CGGCTTCATCCAGGTGCCCCGACGGCCGCACACGACGACAGCTGCGAGCGGCGACAGCAGCAACAATGAGATGCTGGCGG
CGCCGTCTCTGCATGGCCGAGGCGGGCGCAGCAGCCATGGACTGCGCAATATCTCACCGAGCGGGGCAACGATACTGACG
CAGCGGTCGGCAGCGACGACGATGGCGGAGGCGGCGCGGTCGTCGATCCGAGCGGCGGCCAACCTGCTGCCACACAATCG
TGACCGGAAGTGGTTGGACGAGGCCGGCGATATGCTGACCATGTCACCGGGCGGAATGTCGGACGCAGACGAAGACGGCC
TGTCCGAACGGCTGTTTGAAGCACTGAAGCGCAAAGAGTGGGAGCGGTCGGGTAAGTGGCGGCGGATGGCACAGGTTGTG
CGGCGGGAAGGCGGAGACGGCGACAACATGGGCGAAGGCGGCGGCACCGACTACGAGTTCGACCGGCAGCATCCCAAGCT
GGTCGAGCGGACGTGGAAGGGCATCCCGGACTGCTGGCGGGCGGCGGCGTGGTATTCGTTTCTGGCGTCGAGTGCGCGAC
GACACGCCAAGGTGGCCGGCGAGAGGAGCAAGAGCGGACCCGGAAGCATCGCCATTGACGACGACCAGGCGCTCATTGCG
GCCTTTCACCAGCTGCAGCAGACGAGCTCGCCCGACGACATGCAGATCGACCTGGACGTGCCGCGGACAGTCGGTGGTCA
CGTGATGTTCCGCCGTCGATACCGTGGCGGCCAGCGGCTTCTGTTCCGTGTGCTGCACGCGCTGTCTCTCTTCTGTGTCG
CCGGCACGGGCGGCTACGTGCAGGGGATGGCGTCGCTGGCGGCCACGCTGCTGTGCTACTACGACGAGGAGCGGTGCTTT
GTCATGCTGGTGCGGCTGTTTCGACTGCGCGGACTCGAGCGCCTGTACGCACCGGGTTTCGGCGGCCTGGTCGAGACGCT
GGCCGAGTTTGAGCAGCAGTGGCTGGCGCGCAACGGTCAAAACGCGGCCGAGAAGCTGGCCGAGCTGGGCATCGACACCA
TGGCTTATGCCACGCGCTGGTACCTGACGCTATTCAACCTGTCTGTGCCGTTTGCAGCTCAGCTGCGCATCTGGGACGTC
TTCATGCTACTGGGCGACGGCGAGGATGCGCTTGGGGAGGAGGAGGACGATGCAGCAGAGGAGGACGATGCAGCGACGAG
AGGCGAAGCCGGCAATGCAGACGCTGCAGCCCAGAATAACGACACACCCGCTGCCACATCTTCTCTCGCGTCGGGCGACC
TCACCATTCTGCACGCAACCAGCGCCGCTCTCGTCGACGCACTGCAGGACGTGCTGGCCGATGCCGACTTTGAAAACGCC
ATGAAGGCGCTGACATCGTGGATCCCCGTCAAGAACGAGGACCTGCTCATGAAGGTGGTGCACGCAGAGTGGAAGCAGCG
GCAGCGGCGACCCCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62