GenePrediction:GLEAN_5354 Details

Name: GLEAN_5354
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:200316..198864 (- strand)
Length: 1453
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:200316..200183 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_97:200097..200030 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_97:199952..199729 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_97:199670..199263 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_97:199202..198864 (- strand)
Length: 339
>GLEAN_5354 class=GenePrediction position=GCSC_97:200316..198864 (- strand)
ATGAGCGTCGGTGAGGACAAGATGCGCGCTTCGGGCGAGGCTCCTCGAGAGCTGGCACCTGTTCTCCCTACTGTCAACCC
AGAGGCAGAGAAGTCACCATCCAAGCCTTCGGTACCCGCAGTCGCATACGTGATGTATGTCATTGTCATCCGCCGCTGCT
CCCACCATTGTCTTTGCGCCGTACGCTAATTGCTGACTGCTTTTGTTTGCTGCGTGTAGTGCATGGATCGGCCTGAGCTC
GTCTGTCATTCTCTTCAACAAATGGATTCTCCATACCCTCAACTTCCGTATGGCCCTCCCACTCAGAGAGTTCGAAAAAA
GGAAGGCAATGCTGACGAATGTTGTGGCTGACGAAATTGATCAGGCTACCCCGTTATCTTGACAACCTACCACTTGATCT
TCGCGACTATCATGACACAGCTGCTGGCCCGGTACACAACCTTACTAGACGGCCGAAAGGCCGTCAAGATGACCGGCCGG
GTCTACCTCCGTGCCATTGTCCCCATTGGCGTCTTTTTCAGTCTGAGCTTGATTTGCGGCAACCTCACCTACCTCTACCT
GAGCGTTGCATTCATCCAGATGCTCAAGGTAGGCGAGCCGTCCTACTATTTCGCATGTGACAGGCCCGACATTTACTGAC
CAACAGGCTACAACCCCCGTCGCCGTTCTCCTGGCCAGCTGGGCTATGGGCGTCTCTCAGCCCAACCTCAAGGTCTTCAT
GAATGTCATGGTCATCGTTTTCGGGGTTGTCCTCGCCTCTATCGGCGAGATCAGCTTTGTCCTGACCGGCTTCTTGTACC
AGTTGGGTGGAATCGTGTTCGAGGCCCTGCGTCTGACCATGGTCCAGCGCCTGCTGAGCTCTGCAGACTTCAAGATGGAC
CCGCTGGTGTCGCTTTACTACTTTGCCCCCGTTTGTGCTGTTATGAACCTCATGGTTGCGCTTGCATGGGAAGTCCCCAA
GGTGTCGTTGGCTGAATTCCAGAACGTGGGACTTTTCATGTTTGGCTTGAACGGCCTGTGCGCCTTCTTGCTCAACGTCT
CGGTTGTATTCCTGGTAAGTTAAGAAACGTACATTATACGGCTGGCACGAAGTATATTGGACTAACACTTACAGATTGGC
AAAACCTCCGTTCTCGTTCTCACGCTCTGCGGTGTGCTGAAGGACATCCTGCTGGTGGCGGCATCCATGCTGATCTGGGG
CACCCCGGTCACTGGCCTGCAGTTCTTCGGTTATGGCATCGCCCTGTGCGGCATGGTTTACTACAAGCTGGGCTACGAGA
CGCTCAAGACCTACCTGGCCGAGGCTGGCCGCAAGTGGGCCGAGTTTGGTGCCGCACGTCCTGTTCTGCGCAAGATGATC
ATTGTCGGCACTGTTCTCATCGTTGTCATCGGGACTCTTAGCTGGGCCAGCCCTAACAGCCTGCCAACAGGCCTGCCTTC
TGCACGGCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62