GenePrediction:GLEAN_5356 Details

Name: GLEAN_5356
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:189461..188745 (- strand)
Length: 717
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:189461..189439 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_97:189381..188745 (- strand)
Length: 637
>GLEAN_5356 class=GenePrediction position=GCSC_97:189461..188745 (- strand)
ATGAGCTCGCTCTTGACTACGGTGTAGGTGATGTTGAGTCGAGTCGGGATTCGCTCTACTCCATGCTGACCTCTCTGCAG
GAACGCCCGCACGCGGAACCAGTTCCGGCCGCGCGCGCCCGGAAAGGGCGGCAGCACGAGCTACCAGCTGCGACAGTATG
CCGAGGCAACGCTGGGCGGCGGTAGTCTGCGCAAGGTGGTCAAGCTGCCCGAGGGCGAGGATGAGAATGAGTGGCTGGCG
GTCAACATGGTGGATTTTTACAACCAGATCAACCTCCTGTACGGGGCCATCACCGAGTTTTGCTCGCCGCAGTCGTGCCC
CGAGATGAAAGCTACGGACGAGTTTGAGTATCTTTGGCAGGACAGCGAGAACTATAAGAAGCCGACCAAGATGCCGGCGC
CGGCATACGTCGAGCAGCTGATGGCCTGGGTGCAGGGCAACATCGACAACGAGGCTGTGCTACCGAGCCGCATCGGTGTG
CCGTTTCCCAAGAACTTCCCGTCACTGATGCGCCAGATCTTCAAGCGCATGTACCGCGTCTACGCCCACATCTACTGCCA
CCACTACCCCGTCATCCGCGAGCTCGGCCTGGAGCCGCATCTCAACACGAGCTTCAAGCAGTACGTGCTCTTTATCGACG
AGCACCACCTGGCCAGCGGCAAGGACTTTTGGGGGCCGCTGGGCGATTTGGTCGACAGCATGCTGCGGAGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62