GenePrediction:GLEAN_5357 Details

Name: GLEAN_5357
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:188157..187400 (- strand)
Length: 758
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:188157..187993 (- strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_97:187921..187400 (- strand)
Length: 522
>GLEAN_5357 class=GenePrediction position=GCSC_97:188157..187400 (- strand)
ATGCTGTCGAGACAAGCGATGCTGGCGGCCCGGACGGCCTCGGCTGCGCCGCGCATGCTGACTGCGGCGACGCCGGCAGC
CGTGCGGACGTTTGCTGCGGCCGCACCGGACTCGAAGCCGCCCATTGCGCTATTTGGTCTGGACGGGACATATGCGTCTG
CTCTGGTGTGTTTCCTCTTCACAACTCTTCCCCCCCTCTCCTTCCTCTCTTTATCACCCCCTACTAACACCCGCAGTACA
CTGCCGCCGTCAAGACGGCCACCCTCGAGCCTACTGCCAAGAGCCTGGCCGCCCTCGGCAACCTCCTCCGCAAGGACCCC
AAGCTCGTCGGCATCCTGGCCACGCCCACGCTCGCTGCCGCCGACAAGCTCGCCATCGTGGCCGAGCTGCAAAAGGCCAC
CGGCTCGGCCGGCCAGCCAACCGTCACGCACTTTCTGCAGACGCTCGCCGAGAACAACCGGCTCGGCCTGCTCGACGACG
TCGTCGCCAAGTTCGCTGACCTCATCCGCGCTGCCCAGGGCCAGGTCGAGCTCATCGTCACTAGCGCCACTACCCTCGAC
AACAAGACCCTCGCTCGCCTCGAGTCCGCCGTCGCCAAGTCCGCCTTTGTCGGCGCCGGCAAGAAGCTCTCCGTCAAGAA
CAAGGTCAACCCCGAGATCCTCGGCGGCCTCATCGTCGAGGTCGGCGACCGCACCATCGACCTCAGCGTCCTCGCCCGCG
TCGCTAAGCTCAACAAGCTGCTTACTGACAGCTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62