GenePrediction:GLEAN_5358 Details

Name: GLEAN_5358
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:180697..179320 (- strand)
Length: 1378
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:180697..180584 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_97:180453..179932 (- strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_97:179517..179320 (- strand)
Length: 198
>GLEAN_5358 class=GenePrediction position=GCSC_97:180697..179320 (- strand)
ATGGCCACTCCTGCGAGCGACGACGACGTTCTGCTGCCTCCAGATGATGATGCCACCGCGGCTGAGTTTGAGGCTTTTGA
CCGGTTTCCCTGGTCGAAGCACCGCGCATTTCTGGTAAGTTTGTAGCCTTGTCCATCTTGTTCTCTCTTTCTTCTTTCTT
CTTCTTCTTCTCTCTTTCTTCTCTCTCTCTTCTTTCTCTCTTTCTCTTCCTCCCCCCCATCTATCCCCCCTGCTAATCCC
CCAGCTCGGTCTCCTCGAGACGCTCGGCGGCGCCGACGGCCTCTCCCCCAATCCCACCCACCAGGGCAGCACCACCTTCT
GCCGCACCGTCTTCTACCGTCGCCAAACCGGACGGCGCATCGATCTGACCCGCTACAACGGCTTTCTAGCCGCCAGCCCA
GACTACCCATCCATCGACCGTCGCCTGCTGGCGGCCCTGTACGCGGCCAAGAGGGCGGCCACGACCGCTGAGGCGGCAGC
TGCTCTGCGCATCGTCGAGACCGTTGCTGCCGGACCAGCCATCAACCCGTTTGACGGCACGGCAACACCGCATGACGATG
CTGTGCCGTCGTGGCAACGCAGCGCTCCGAAGAACGAGCTGCGCGTGCCGCGGGCGGCAGCAGCAGCGGACGAGGCTGCT
GGTGCAAGTGCGGCCAACGGCGAGGCGCCGTACTCGGACAAGTTCGCCAAGGTCATCGAGGCCGTGCAGACGGGAAAGGA
GCTCGAAGGCATCCGGCACATACCCGACACAGTCGTGCGCCAAGAAGTAAGTGCAGCTGGTCAGAGGCCTGTCCTCTGGC
TTTGTTTCATGTCTTGGAGGGGTTCTTTCCTTCTCTTCTTTCCTTTTTCTTCTTTCCTTTTTCTTTCTTCCTTTTTCTTC
TTTCCTTTCTTCTTCTATCCCTCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCT
TCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCT
TCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTCTACCTTCCCTTCTTC
TACCTTCCCTTCTTCTACCTTCCCTTCTTCTCCCTCTTCTTTCCTCCCCTAACCTTCTAGGGCATCACCCCCTTAGGCAA
GCTCAAGCCCCCCAAGAAACCATGGGAAACAGCCGCTGCGCCAACCGCTTCTCTGGCATCTGCTCTGGCTTTTGGCGCTC
CAATCACAACCGAGTCTGGCCACTCGCTGCTGGTCGACTTGCACTTTCCACCTCCGCCAGAACAGTCTGGGCCTGTCCAA
TCAGAAGTAGGCCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62