GenePrediction:GLEAN_5359 Details

Name: GLEAN_5359
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:170602..166152 (- strand)
Length: 4451
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:170602..170564 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_97:170507..170302 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_97:170244..170195 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_97:168806..168697 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_97:168567..168493 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_97:168427..167366 (- strand)
Length: 1062
Type: CDS
Source: GLEAN
Position: GCSC_97:167299..166673 (- strand)
Length: 627
Type: CDS
Source: GLEAN
Position: GCSC_97:166620..166328 (- strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_97:166278..166152 (- strand)
Length: 127
>GLEAN_5359 class=GenePrediction position=GCSC_97:170602..166152 (- strand)
ATGAGTGTCCCACGCCCCCGACTTCTGGACCTGATGAAGGTAGGCTCGACTCTACACTTCAAAGTCAGACAACGGCACCC
GCTGACTCCGTACAGATCCAATGCAAGATTTTCGCGACCACATTCAACCCCGAAGGCGTACGCATGGGCAACAAGGTTCT
GCGACAGAGACTTCGAGGCTCTGCCTTGGCAGCATACTACCCGAGAAGAGTAGTCACGTTCAAGGATCTGCAAAGGGGGT
TTGGTCCCGATTTGATAGCGGACGATGAGCTGGACGCAGACCGGCTAGAGAGCAATGCTGGGTAAGTGCTTCTGGCTCTG
CGCGGTAACAGCAAACGACAGGACTAATACCTCAACAGATTGCGCGCTCGTGGCAAGGGCCAGACAAAGAGAAGAGGTAC
AGCAGCAGGTACGATTTCCCGTCACTGAAAAAGATCATGTGGTGACTTTTCGGAGCTTCCGACTAACGGTGTAAGCAGAT
AACAAAGGGAAAGGAAAGAAATGATCCGGATAGATTTTGTGCAATACACACGGGAATACAGGAAATCAATGATACTCAAT
TTGACGTCGTTGGGTTGTGTGGCCTACTATCAAGAGCGTACTTCTTTGACGCTTGTCTGGTGGTCATTCAAAAAGCCTTG
GCTGGCGTGTTGTTCGGCATCACTGCTCGTTCGTTCTCTTTCCACATTTGACGCGGTGTATTACGTCGGCAGCATTTAGA
CGTGAGAAAAATCCGAGTGGCCGGGAATTGAGAATAGCAGGCAGCTTACGCTGTCCGTCAAGCCACGGCCTCGTAAGAGC
TCATTGGCATTTGCTATTTGTAGAAGTTTCGAAGCAACGAGCCGGTTTCGATCAAAGCCAAAATTACTTTTAGGCACCCC
TTGCAATCGAGGAAGCCGCCATCTCGGGGAAACTTGTCACCATAACGAATACTAGATATTGTATGGCGTGTTTTCGGGGC
TTCTTCCTCCCTCTCTTGCCCGGCTCAGATTATCTATTCTCTGGGTTTCTTTCCTGCTTCAGAAATTTCTCAGCATTCTT
ACCTTTCGCTCTTTCCTTTCATGCTTTGATTTCCACTTTCACGCCACATATTGACGTCCCTGCCCACTTCTCGAATCTCC
TTTCCTCCCAAAACCACCATCCTTACACATCTTCACTCTGCCGTCCCTGTCGCCTTCCTCAAACAGACGGCGAGCGCTAC
GAGTGTAACCTTCCAATCTTGTGGTCTCTTTTTTTTTTGACGCGCCTTTGACGCGCTTCCTTCGTTTTCTACCCCACAGT
CCAGTTTCATTGACTCGCCATTCACGTATTTATTTGACTGGCGTTAAATATCGTGTGCGCTCTCTGCATCCCACCGTCTC
CTGTGTCCGTCTTTCCTTCCCTATATCTCCTGATGACAACTTTCCCCCAAGCATTTTGAGTTTCCTGATATGGTAAGAAG
CTCTTCAAGAGCCGGTCGGCCTTTCCTACCAGGATACTCAGATTTTTGTGCCATATATCTTATCTGACACCTGGCTATAT
TCACTATTTACATCCTTTTTTGAATCTATCCATGAGACTTTGTTTTCTCCTCTTCTTTCTCTTCTTATCCCCTTTGACCC
CTCTCATCACCAACTCTGCGCCCTCTTTGTTGCCACCCCCATCAAAGCATCCCCTTCTTGTCTTTCCTTTCTTTGGGTTA
CTAGCCGATTTAAAACGGCATCATCACTGTCAGTTACATGCCAACTGCACCAGTCATTCTAGCCTTCTAGCTCAAATTCT
GTCTCTGGACAAAACTGCTGGAGGACATGTCTGCAGTTGCACCGACCGGATCGCCCCGTCAGCGTCGCCAGTCTGGCACC
AAGGGTATAGGTCAGGATGAGAACGTGCTGAGAAACTCAGAAGATGCCAGTATGCAGAGCTCTCAGGTTCGTGCAAATAC
CGTCTGGCCGAGCTATGGTGGCAGTCCTGTTAATTTGATCCCTTCCAATAAATTGCAATTTAACGCCTGCAGAATGACGA
CGAAATCTGTCACTGACATGATATTCTTTTTTCAGGATTCCTTTGGCAACCTGCGAAAGGGGTTAGTGACACTGAAAACT
GCGAAGCTCGCCAACCAGAAGGGGCCCAACGTATGAATCTCCGGCTCTTTCGCGTCCTGATCTCATAATCAAAGCTAATA
ACATTGTCTTCATAGCCGGGCTATGATTCAGGAACCTCGTCTAGCGTATATCCCATGGATACTCTCCTTGCGAAGTTGTC
CGAGCAAGAGGCTGCGATCCGTGAACAGAACGATAGTATGAAAAAGAAGGCGGAGGAAGAAGCTGTTTATAGCCGGATGT
CTGAGACACAATCCGTTTGCATCTCTGGCCCCATCCCCGGGACGGCTGATGGGTTCAACGGCCCTTCTGATATGATGTCA
GGCTCTACAAGCATCATCACCGATGGTGATCCCGCAACATCAGAAGAGCTGCTCCGCCTCAAACTTGAACTTGCACAGGC
TCAAGTCAAGATAACGCGACTTGACCATGAACTGGCGCACTCCCGGTTTGCCAAGTCGGACAACTCCAATATGATATCTT
TGACTATGCCGGAGCCAGATTACCCTACACTTCCCAGATTTGATCAGCCTGTCTCTCGTTCCACCGGTGCCATTGCGGCC
ATGTCCGCGACCAAGCCGCTATACTCTCGAGACAATATCTGGCTACTTCCCGAAGATGGACGATCGGACACAGTGGAACC
ATCCACTGCCGGTACCATAGGGAGATCTCGTGGAGTTTGGCGCAACGATCCAAAACCAGCTGTCTTCCAGCATCCGTTTG
CTACAGCACCACCTTCGATCCCCATGTCCGATAGTCTTCCTACCCAACCGGCATCTATCTGGCCACCCGTGCGACCTAGC
AACCCAAGCTTCATGGAGTCCAGTTCCCAGATTTTCGGAGATTCATCGACTGCCATAGATGACGGCCCAAGCGGCCGCTT
GACACCAGATAGCGATGTCCTCTTGCGACCCCCGTCCCGGCGTCGGGGAAGTCGACTTGACACTCACATGGTTTCCAACC
AGGGCTTTGGAGGTTATGGTACTTTCAACATGGGGCAGATGCAGTATGACAGTTCGAATGAGTTTTCTTCCGGGGGCAGC
TCTCAGATACTCAATGCTGGAATGTTTCCCCAATATCAACAGCAGCCTATTGGTACTCCGTTGTCTCCTCACGCAACAGA
GTTCAGCGCAGGCACTGGACCGCCTTGGAAGAACGAGGTAGGTTGTTCAGATATGGAGAAGGCTGATCTTGATTTAGGGG
TGGCGTCACTAATTATTTTCCAGAATTCTCTCTCCGAAAATCCAACATTTGTGCCTACGACGGAGCCACTGAACTACCGT
CGGCTACTCGACCGCAACGTCAACTGCAACTGGAAGTACATTGTAGACAAGATTGTTTGCAACAATGACCAACAGGCGTC
TATCTTTCTGCAACAAAAACTGAAAGTTGGCACTACCGATCAGAAGTATGACATTGTGGAGGCCATTGTTTCCCAGGCAT
ACCCCTTGATGATCAACCGCTTTGGCAACTTTTTAGTTCAGCGTTGCTTTGAACACGGTGCACCGGAGCAAATCGTCAAA
ATCGCAGAGGCTATCCGTGGAAACACGCTCAATCTCTCTATGGATCCATTTGGATGTCATGTGGTCCAGAAGGCGTTTGA
CTCAGTCACTGAAGACTACAAGGCGATTATGGTACATGAGCTGCTCCGACGCATTCCGGAAACGGTTATTCACCGTTATG
CTTGCCATGTCTGGCAGAAGCTTTTTGAGCTGCGATGGAATGACTCGCCTCCCCAGATTATGAAATACGTCAATGAAGCA
CTGTGCGGTATGTGGCACGAGGTTGCTCTCGGGGAAACCGGTAGCCTTGTGGTGCAGAACATCTTTGAAAACTGTCTGGA
GGAAGACAAGGTATGTGATCCTATAAATTTCCAGGGGTTCGTTCTGAAACTGATACTCAAAGCGTCCATGCATCGAGGAG
GTTCTGGGAAACATTGATGTTGTTGCTCATGGCCAATTTGGCAACTGGTGCATCCAGCACATATGCGAGCATGGCGCGCC
GAACGATCGCGGCCGGGCGATTGACCATGTTGTCCACTACGCTGCCGAGTACAGCATGGACCAGTTTGCATCCAAGGTAG
TGGAAAAGTGTCTGAAAATTGGCGGTGCCGAATTCTTGGGCCGCTATTTAGACCGTGTCTGCGAGGGACGAGTTGATCGG
CCACGCATCCCGCTCATCGACATAGCCAGCGACCAGTATGGCAACTACCTGATCCAGTACGTATTGACGCATGCGAATCC
GCAGCACCGAGAGGTTGTCGCAGCACACATCCGGAAGCACATGGTATCGCTCCGAGGATCGAAGTTTGGATCCCGAGTCG
GCATGCTCTGCACGAATCCAGCCGTTGCAACTCGGCCTGGTCCAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62